Difference between revisions of "Texas Xenopus Genome Project/Species Identification"

From Marcotte Lab
Jump to: navigation, search
(Selection procedure)
(XENTR_CHORI-219_ID.2 (hoxa5))
 
(14 intermediate revisions by one user not shown)
Line 1: Line 1:
== Target gene ==
+
== Designed ==
* pfas (phosphoribosylformylglycinamidine synthase). PREDICTED from human Entrez gene.
+
=== XENTR_CHORI-219_ID.2 (hoxa5) ===
** http://www.ncbi.nlm.nih.gov/nuccore/213983084
+
* Only cut XENTR - [http://rebase.neb.com/rebase/enz/PsrI.html PsrI](119, 151).
** http://www.xenbase.org/gene/showgene.do?method=displayGeneSummary&geneId=6001437
+
* Only cut XENLA - None.
 +
* PCR primer (designed by Primer3)
 +
<pre>
 +
OLIGO            start  len      tm    gc%  any    3' seq
 +
LEFT PRIMER        24  20  59.99  45.00  2.00  0.00 caagagccacaaatcaagca
 +
RIGHT PRIMER      221  20  59.92  50.00  5.00  1.00 agatccatgccattgtagcc
 +
</pre>
 +
 
 +
<pre>
 +
XENLA_CH219-206K  1 + gtgctatagacgcgcaaaacgaccaagagccacaaatcaagcacacatatcaaaaaacaaatga 64
 +
XENTR_NM_0010114  1 + gtgctatagacgcgcaaaacgaccaagagccacaaatcaagcacacatatcaaaaaacaaatga 64
 +
                      ****************************************************************
 +
                                              >>>>>>>>>>>>>>>>>>>>
 +
XENLA_CH219-206K  65 + gctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttacataa 128
 +
XENTR_NM_0010114  65 + gctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttacataa 128
 +
                      ****************************************************************
 +
 
 +
XENLA_CH219-206K 129 + ttatggagatcagagctcggtgagcgagcaatacagggatacaacgagcatgcattccagcagg 192
 +
XENTR_NM_0010114 129 + ttatggagatcacagctcggtgaacgagcaatacagggatacaacgagcatgcattccagcagg 192
 +
                      ************ ********** ****************************************
 +
 
 +
XENLA_CH219-206K 193 + tacggatacggctacaatggcatggatctcagcgttgggcgctcagcttccaaccactttagtg 256
 +
XENTR_NM_0010114 193 + tacggatacggctacaatggcatggatctcagcgttgggcgctcagcttccaaccactttagtg 256
 +
                      ****************************************************************
 +
                                <<<<<<<<<<<<<<<<<<<<
 +
XENLA_CH219-206K 257 + ccaatgacagagcaaggaattatccatccaatccgagctcctctacagagccaaggtataacca 320
 +
XENTR_NM_0010114 257 + ccaatgacagagcaaggaattatccatccaatccgagctcctctacagagccaaggtataacca 320
 +
                      ****************************************************************
 +
 
 +
XENLA_CH219-206K 321 + acctgcagcctct 333(1)
 +
XENTR_NM_0010114 321 + acctgcagcgtct 333(1)
 +
                      ********* ***
 +
</pre>
 +
 
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.2.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.2.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.25 (hoxa3) ===
 +
* Only cut XENTR - BccI(136), BfiI(110), BglII(21), BstEII(140), Eco57I(72), Eco57MI(72), MboII(78), MmeI(115), PflMI(134), PleI(118), Tsp45I(99), TspDTI(59), TspRI(123,178)
 +
* Only cut XENLA - BciVi(136,167), BspMI(156), EcoP15I(193), HphI(136), MslI(105), NspI(157), SacI(44,122), SphI(157), TspGWI(157)
 +
* PCR primer
 +
<pre>
 +
OLIGO            start  len      tm    gc%  any    3' seq
 +
LEFT PRIMER        161  20  60.21  50.00  7.00  2.00 cctcaccgagaggcaaatta
 +
RIGHT PRIMER      351  20  59.68  60.00  5.00  3.00 gaggctcataggggacactg
 +
</pre>
 +
 
 +
<pre>
 +
XENLA_CH219-206K  1 + gtgagagctgtgcaggagacaaaagtcccccggggcaatcctcttccaaaagggcccgcactgc 64
 +
XENTR_NM_0011274  1 + gtgagagttgtgctggagacaaaagccccccggggcaatcctcttccaagagggcccgcactgc 64
 +
                      ******* ***** *********** *********************** **************
 +
 
 +
XENLA_CH219-206K  65 + ttacacaagcgctcagctggtagaactggaaaaagagttccactttaacagatacctgtgcaga 128
 +
XENTR_NM_0011274  65 + ttacacaagcgctcagctggtagaactggaaaaagagttccactttaacagatacctgtgcaga 128
 +
                      ****************************************************************
 +
 
 +
XENLA_CH219-206K 129 + cccaggagggtggagatggccaatctactcaacctcaccgagaggcaaattaagatctggtttc 192
 +
XENTR_NM_0011274 129 + cccaggagggtggagatggccaatctgctcaacctcaccgagaggcaaattaagatctggtttc 192
 +
                      ************************** *************************************
 +
                                                      >>>>>>>>>>>>>>>>>>>>
 +
XENLA_CH219-206K 193 + agaacaggcgaatgaaatacaaaaaggatcaaaaagggaaatccatgatgacctcttcaggagg 256
 +
XENTR_NM_0011274 193 + agaacaggcgaatgaaatacaaaaaggatcaaaaagggaaatccatgatgacctcttcaggagg 256
 +
                      ****************************************************************
 +
 
 +
XENLA_CH219-206K 257 + acagtcaccatgtaggagcccggtgccagctccatctgttggaggttacctaaactctatgcat 320
 +
XENTR_NM_0011274 257 + gcagtcaccatgtaggagcccagtgccgactccatctgttggaggttacctaaactctatgcat 320
 +
                        ******************** *****  ***********************************
 +
 
 +
XENLA_CH219-206K 321 + tctttggtaaacagtgtcccctatgagcctcagtctccccctg 363(1)
 +
XENTR_NM_0011274 321 + tctttggtaaacagtgtcccctatgagcctcagtctcccccag 363(1)
 +
                      ***************************************** *
 +
                                  <<<<<<<<<<<<<<<<<<<<
 +
</pre>
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.25.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.25.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.28 (pitx-1) ===
 +
* Only cut XENTR - SfaNI(46),TauI(52)
 +
* Only cut XENLA - BciVI(78),FauI(42),Hpy99I(72)
 +
* PCR primer
 +
<pre>
 +
OLIGO            start  len      tm    gc%  any    3' seq
 +
LEFT PRIMER        42  20  60.12  55.00  5.00  2.00 gaaccagcagatggacctgt
 +
RIGHT PRIMER      194  20  59.84  50.00  4.00  0.00 aaggtgaagctcttggtgga
 +
</pre>
 +
<pre>
 +
XENLA_CH219-166K  1 + tggttcaagaaccgccgagccaagtggaggaagagggagcggaaccagcagatggacctgtgta 64
 +
XENTR_NM_0010074  1 + tggttcaagaaccgcagagccaagtggaggaagagggagcggaaccagcagatggacctgtgca 64
 +
                      *************** ********************************************** *
 +
                                                              >>>>>>>>>>>>>>>>>>>
 +
XENLA_CH219-166K  65 + agaatggttacgtgccccagttcagcgggctcatgcagccgtacgacgagatgtacgcaggata 128
 +
XENTR_NM_0010074  65 + agaatggctacgtgccccagttcagcggcctgatgcagccctacgatgagatgtacgctggcta 128
 +
                      ******* ******************** ** ******** ***** *********** ** **
 +
 
 +
XENLA_CH219-166K 129 + cccctacaacaactgggccacaaaaagcctcacccctgcccccctgtccaccaagagcttcacc 192
 +
XENTR_NM_0010074 129 + cccgtacaacaactgggccaccaaaagcctcacccctgcccccctgtccaccaagagcttcacc 192
 +
                      *** ***************** ******************************************
 +
                                                                    <<<<<<<<<<<<<<<<<<
 +
XENLA_CH219-166K 193 + ttcttcaactccatgagtcccttgtcttcccagtccatgttctccggccccagctccatctctt 256
 +
XENTR_NM_0010074 193 + ttcttcaactccatgagtccgctgtcctcccagtccatgttctctggccccagctccatctctt 256
 +
                      ********************  **** ***************** *******************
 +
                      <<
 +
XENLA_CH219-166K 257 + ccatgagcatgccctccagcatgggtcactctgcggtgccaggcatggccaactc 311(1)
 +
XENTR_NM_0010074 257 + ccatgagcatgccctccagcatgggccactcggcggtgcccggcatgcccaactc 311(1)
 +
                      ************************* ***** ******** ****** *******
 +
</pre>
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.28.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.28.muscle|MUSCLE file]]
 +
 
 +
== Candidates ==
 +
=== XENTR_CHORI-219_ID.3 (hoxa5) ===
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.3.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.3.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.24 (hoxa3) ===
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.24.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.24.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.26 (hoxa3) ===
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.26.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.26.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.27 (pitx-1) ===
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.27.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.27.muscle|MUSCLE file]]
 +
 
 +
=== XENTR_CHORI-219_ID.29 (pitx-1) ===
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.29.fasta|FASTA file]]
 +
* [[:xdata:ID/XENTR_CHORI-219_ID.29.muscle|MUSCLE file]]
  
 
== Selection procedure ==
 
== Selection procedure ==

Latest revision as of 15:43, 9 December 2009

Contents

Designed

XENTR_CHORI-219_ID.2 (hoxa5)

  • Only cut XENTR - PsrI(119, 151).
  • Only cut XENLA - None.
  • PCR primer (designed by Primer3)
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER         24   20   59.99   45.00  2.00  0.00 caagagccacaaatcaagca
RIGHT PRIMER       221   20   59.92   50.00  5.00  1.00 agatccatgccattgtagcc
XENLA_CH219-206K   1 + gtgctatagacgcgcaaaacgaccaagagccacaaatcaagcacacatatcaaaaaacaaatga 64
XENTR_NM_0010114   1 + gtgctatagacgcgcaaaacgaccaagagccacaaatcaagcacacatatcaaaaaacaaatga 64
                       ****************************************************************
                                              >>>>>>>>>>>>>>>>>>>>
XENLA_CH219-206K  65 + gctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttacataa 128
XENTR_NM_0010114  65 + gctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttacataa 128
                       ****************************************************************

XENLA_CH219-206K 129 + ttatggagatcagagctcggtgagcgagcaatacagggatacaacgagcatgcattccagcagg 192
XENTR_NM_0010114 129 + ttatggagatcacagctcggtgaacgagcaatacagggatacaacgagcatgcattccagcagg 192
                       ************ ********** ****************************************

XENLA_CH219-206K 193 + tacggatacggctacaatggcatggatctcagcgttgggcgctcagcttccaaccactttagtg 256
XENTR_NM_0010114 193 + tacggatacggctacaatggcatggatctcagcgttgggcgctcagcttccaaccactttagtg 256
                       ****************************************************************
                                <<<<<<<<<<<<<<<<<<<<
XENLA_CH219-206K 257 + ccaatgacagagcaaggaattatccatccaatccgagctcctctacagagccaaggtataacca 320
XENTR_NM_0010114 257 + ccaatgacagagcaaggaattatccatccaatccgagctcctctacagagccaaggtataacca 320
                       ****************************************************************

XENLA_CH219-206K 321 + acctgcagcctct 333(1)
XENTR_NM_0010114 321 + acctgcagcgtct 333(1)
                       ********* ***

XENTR_CHORI-219_ID.25 (hoxa3)

  • Only cut XENTR - BccI(136), BfiI(110), BglII(21), BstEII(140), Eco57I(72), Eco57MI(72), MboII(78), MmeI(115), PflMI(134), PleI(118), Tsp45I(99), TspDTI(59), TspRI(123,178)
  • Only cut XENLA - BciVi(136,167), BspMI(156), EcoP15I(193), HphI(136), MslI(105), NspI(157), SacI(44,122), SphI(157), TspGWI(157)
  • PCR primer
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER        161   20   60.21   50.00  7.00  2.00 cctcaccgagaggcaaatta
RIGHT PRIMER       351   20   59.68   60.00  5.00  3.00 gaggctcataggggacactg
XENLA_CH219-206K   1 + gtgagagctgtgcaggagacaaaagtcccccggggcaatcctcttccaaaagggcccgcactgc 64
XENTR_NM_0011274   1 + gtgagagttgtgctggagacaaaagccccccggggcaatcctcttccaagagggcccgcactgc 64
                       ******* ***** *********** *********************** **************

XENLA_CH219-206K  65 + ttacacaagcgctcagctggtagaactggaaaaagagttccactttaacagatacctgtgcaga 128
XENTR_NM_0011274  65 + ttacacaagcgctcagctggtagaactggaaaaagagttccactttaacagatacctgtgcaga 128
                       ****************************************************************

XENLA_CH219-206K 129 + cccaggagggtggagatggccaatctactcaacctcaccgagaggcaaattaagatctggtttc 192
XENTR_NM_0011274 129 + cccaggagggtggagatggccaatctgctcaacctcaccgagaggcaaattaagatctggtttc 192
                       ************************** *************************************
                                                       >>>>>>>>>>>>>>>>>>>>
XENLA_CH219-206K 193 + agaacaggcgaatgaaatacaaaaaggatcaaaaagggaaatccatgatgacctcttcaggagg 256
XENTR_NM_0011274 193 + agaacaggcgaatgaaatacaaaaaggatcaaaaagggaaatccatgatgacctcttcaggagg 256
                       ****************************************************************

XENLA_CH219-206K 257 + acagtcaccatgtaggagcccggtgccagctccatctgttggaggttacctaaactctatgcat 320
XENTR_NM_0011274 257 + gcagtcaccatgtaggagcccagtgccgactccatctgttggaggttacctaaactctatgcat 320
                        ******************** *****  ***********************************

XENLA_CH219-206K 321 + tctttggtaaacagtgtcccctatgagcctcagtctccccctg 363(1)
XENTR_NM_0011274 321 + tctttggtaaacagtgtcccctatgagcctcagtctcccccag 363(1)
                       ***************************************** *
                                  <<<<<<<<<<<<<<<<<<<<

XENTR_CHORI-219_ID.28 (pitx-1)

  • Only cut XENTR - SfaNI(46),TauI(52)
  • Only cut XENLA - BciVI(78),FauI(42),Hpy99I(72)
  • PCR primer
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER         42   20   60.12   55.00  5.00  2.00 gaaccagcagatggacctgt
RIGHT PRIMER       194   20   59.84   50.00  4.00  0.00 aaggtgaagctcttggtgga
XENLA_CH219-166K   1 + tggttcaagaaccgccgagccaagtggaggaagagggagcggaaccagcagatggacctgtgta 64
XENTR_NM_0010074   1 + tggttcaagaaccgcagagccaagtggaggaagagggagcggaaccagcagatggacctgtgca 64
                       *************** ********************************************** *
                                                               >>>>>>>>>>>>>>>>>>>
XENLA_CH219-166K  65 + agaatggttacgtgccccagttcagcgggctcatgcagccgtacgacgagatgtacgcaggata 128
XENTR_NM_0010074  65 + agaatggctacgtgccccagttcagcggcctgatgcagccctacgatgagatgtacgctggcta 128
                       ******* ******************** ** ******** ***** *********** ** **

XENLA_CH219-166K 129 + cccctacaacaactgggccacaaaaagcctcacccctgcccccctgtccaccaagagcttcacc 192
XENTR_NM_0010074 129 + cccgtacaacaactgggccaccaaaagcctcacccctgcccccctgtccaccaagagcttcacc 192
                       *** ***************** ******************************************
                                                                     <<<<<<<<<<<<<<<<<<
XENLA_CH219-166K 193 + ttcttcaactccatgagtcccttgtcttcccagtccatgttctccggccccagctccatctctt 256
XENTR_NM_0010074 193 + ttcttcaactccatgagtccgctgtcctcccagtccatgttctctggccccagctccatctctt 256
                       ********************  **** ***************** *******************
                       <<
XENLA_CH219-166K 257 + ccatgagcatgccctccagcatgggtcactctgcggtgccaggcatggccaactc 311(1)
XENTR_NM_0010074 257 + ccatgagcatgccctccagcatgggccactcggcggtgcccggcatgcccaactc 311(1)
                       ************************* ***** ******** ****** *******

Candidates

XENTR_CHORI-219_ID.3 (hoxa5)

XENTR_CHORI-219_ID.24 (hoxa3)

XENTR_CHORI-219_ID.26 (hoxa3)

XENTR_CHORI-219_ID.27 (pitx-1)

XENTR_CHORI-219_ID.29 (pitx-1)

Selection procedure

  • Download CHORI-219 sequences (from NCBI GenBank).
 blat XENLA_CH219.fasta XENTR_mRNA.xenbase20091127.fasta XENTR_mRNA.XENLA_CH219.blat_pslx -out=pslx
  • Parse two BLAT output files with the following criteria.
    1. From X. tropicalis mRNA, only RefSeq (starts sith 'NM_') sequences are considered.
    2. Select X. tropicalis mRNA sequences which hit both CHORI-219 (minimum match length is 200 bp to be called as a 'hit'). I only consider 10 CHORI-219 BACs which we already knew that they are available ('74I8','204L9','197E3','71P23','36I4','35I18','262A22','20I13','206K7','166K18').
    3. Survey each hit blocks. If the hit block is less than 200 bp, discard it. 42 hit blocks from 8 mRNAs are selected.
      • NM_001004837 Unnamed, predicted gene MGC69309 NCBIXenBase
      • NM_001007499 paired-like homeodomain 1 (pitx-1) NCBIXenBase
      • NM_001011405 Homeobox A5 (hoxa5) NCBIXebBase
      • NM_001035121 CCAAT/enhancer binding protein (C/EBP), beta (cebpb) NCBIXenBase
      • NM_001113032 LY6/PLAUR domain containing 6 (lypd6) NCBIXenBase
      • NM_001127429 homeobox A3 (hoxa3) NCBIXenBase
      • NM_001129937 SRY (sex determining region Y)-box 18 (sox18) NCBI XenBase
      • NM_001142220 phosphoribosylformylglycinamidine synthase (pfas) NCBIXenBase
  • Run MUSCLE (version 4.0, with default option) for multiple sequence alignment. I found that most of candidate sequences have duplications. So I filtered them out based on 'Self' mapping information from MUSCLE output (if a sequence is mapped itself longer than 50 bp). Finally 10 fragments are selected.
    • hoxa3 - XENTR_CHORI-219_ID.24.muscle, XENTR_CHORI-219_ID.25.muscle, XENTR_CHORI-219_ID.26.muscle
    • pitx-1 - XENTR_CHORI-219_ID.27.muscle, XENTR_CHORI-219_ID.28.muscle, XENTR_CHORI-219_ID.29.muscle
    • hoxa5 - XENTR_CHORI-219_ID.2.muscle, XENTR_CHORI-219_ID.3.muscle
 $ mus4 -i XENTR_CHORI.fasta -o XENTR_CHORI.muscle 

Here's the example of Self duplication.

>XENTR_NM_001113032_18 gi|163915026|ref|NM_001113032|

  3 + ccaggggtacccagggcacaaataagcactcaccccaaatccccccctaactggccttcaggct 66
      ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
138 + ccaggggtacccagggcacaaataagcactcaccccaaatctccccctaactggccttcaggct 201

 67 + gggcccccttagcccataacaaggttacagatagttagaaacattggg 114
      |||||||||||||||||||||||||||||||||  |||||||||||||
202 + gggcccccttagcccataacaaggttacagatatatagaaacattggg 249