BCH394P BCH364C 2025: Difference between revisions
No edit summary |
|||
| (38 intermediate revisions by the same user not shown) | |||
| Line 10: | Line 10: | ||
== Lectures & Handouts == | == Lectures & Handouts == | ||
'''Apr 17 - 24, 2025 - Final Project Presentations''' | '''Apr 17 - 24, 2025 - Final Project Presentations''' | ||
* Welcome to the end of the course! You made it! The last 3 days will be presentations of your class projects. | * Welcome to the end of the course! You made it! The last 3 days will be presentations of your class projects. | ||
* | * '''Please don't forget to do the Course - Instructor Survey on Canvas!''' | ||
Here's a sampling of some of the completed course projects (posted with permission): | Here's a sampling of some of the completed course projects (posted with permission): | ||
* [https:// | * [https://ira-zibbu.github.io/picocell/ picocell, a protein-language model guided simulation of cellular evolution, by Ira Zibbu] | ||
* [https:// | * [https://collinformatics-mocha.up.railway.app/ Motif Orientation and Characterization for High-throughput Assays (MOCHA), by Collin Andrews and Anjana Ram] | ||
* [https://sites.google.com/view/ | * [https://sites.google.com/view/sphk1bioinformatics/introduction Bioinformatics Analysis of SPHK1 Mutations in Prostate Cancer, by Akankshya Satapathy, Mairepaiti Halimulati, Tatiana Guaraca] | ||
* [https://sites.google.com/ | * [https://sites.google.com/view/bioinfo-project-anik/ Decoding Virus-Activated Micropeptides in lncRNAs, by Anik Mojumder] | ||
* [https://sites.google.com/view/ | * [https://sites.google.com/view/bch394p-final-project/overview MLO-A5 Tag-Sec Data Analysis, by Han Ding] | ||
* [https://sites.google.com/utexas.edu/ | * [https://sites.google.com/utexas.edu/zbch-390p-project-ziyixu/home Sex-specific Regulatory Elements on Genes Involved in Feeding and Energy Expenditure, by Ziyi Xu] | ||
* [https://sites.google.com/utexas.edu/ | * [https://sites.google.com/utexas.edu/barcodey Barcoded amplicon reads: consensus Generation and organized demultiplexing engineered for you, by Mohammadreza Mojoudi and Sabranth Gupta] | ||
* [https://sites.google.com/utexas.edu/ | * [https://sites.google.com/utexas.edu/bioinformaticsfinalproject/home Metabolic Profiling to Explore the Effects of GLS1 Inhibition by CB-839 and its Structural Mechanism, by Sukyoung Choi, Yujin Lee, Kangsan Kim] | ||
* [https:// | * [https://ekeleme.my.canva.site/predicting-site-specific-nitrite-modification-of-heme-proteins-using-machine-learning Predicting Site-Specific Nitrite Modification of Heme Proteins Using Machine Learning, by Laura Ekeleme] | ||
* [https://sites.google.com/ | * [https://sites.google.com/view/bio394p-yujie-he PDAC Prediction with a Urine Biomarker Penal, by Yujie (Janet) He] | ||
* [https://sites.google.com/ | * [https://sites.google.com/utexas.edu/bioinformaticsproject/home Comparative Analysis of Pseudouridine (Ψ) Detection in PM-Exposed Lung Cells: Nanopore Direct RNA Sequencing vs. BID‑Seq, by Morgan Stephens] | ||
* [https://sites.google.com/utexas.edu/ | * [https://sites.google.com/utexas.edu/bch364cfinalproject-akulsaxena?usp=sharing Mining and Classifying Antimicrobial Peptides (AMPs), by Akul Saxena] | ||
'''April 15, 2025 - Synthetic Biology, highly compressed''' | '''April 15, 2025 - Synthetic Biology, highly compressed''' | ||
* '''Reminder: All projects are due by 10PM, April 16'''. Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR. | * '''Reminder: All projects are due by 10PM, April 16'''. Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR. | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_SyntheticBio_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_SyntheticBio_Spring2025.pdf Today's slides] | ||
* Reminder that the CBRS is offering [https://site.research.utexas.edu/cbrs/classes/short-courses/spring-2025-semester/ short (1 day) courses on computational bio topics], including stats modeling, unix/linux, bash scripting, and more | |||
* TACC is hosting [https://web.cvent.com/event/14a23b1c-02d7-45f2-b1fe-2b45087c6c17/summary TACC Institute - Machine Learning for Life Sciences Research], an "immersive dive into machine learning best practices and applications in life sciences" from May 19-23 | |||
* Food for thought: [https://colossal.com/ Colossal.com], [https://www.nytimes.com/2025/04/07/science/colossal-dire-wolf-deextinction.html?unlocked_article_code=1.904.7dW8.v8XoKQwLbBee&smid=url-share a fairly nuanced report of their recent progress on the dire wolf], and [https://www.bbc.com/news/articles/c4g9ejy3gdvo criticism of characterizing it as de-extinction] | |||
A collection of further reading, if you're so inclined: | A collection of further reading, if you're so inclined: | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/GenomeTransplantation.pdf Genome Transplantation] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/GenomeTransplantation.pdf Genome Transplantation] | ||
| Line 43: | Line 45: | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BacterialPhotography.pdf Bacterial photography] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BacterialPhotography.pdf Bacterial photography] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/EdgeDetector.pdf Edge detector] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/EdgeDetector.pdf Edge detector] | ||
'''April 10, 2025 - Orthologs, Paralogs, and Phenologs''' | '''April 10, 2025 - A case study in using bioinformatics and public data to make new discoveries (Orthologs, Paralogs, and Phenologs)''' | ||
* '''Remember: The final project web page is due by 10PM April 16, 2025, turned in as a URL emailed to the TA+Professor. Please indicate in the email if you are willing to let us post the project to the course web site. Also, note that ''late days can't be used for the final project'' ''' | * '''Remember: The final project web page is due by 10PM April 16, 2025, turned in as a URL emailed to the TA+Professor. Please indicate in the email if you are willing to let us post the project to the course web site. Also, note that ''late days can't be used for the final project'' ''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_Phenologs_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_Phenologs_Spring2025.pdf Today's slides] | ||
* [http://www.marcottelab.org/paper-pdfs/PNAS_Phenologs_2010.pdf Phenologs] and the [http://www.marcottelab.org/paper-pdfs/PLoSBiology_TBZ_2012.pdf drug discovery story] we'll discuss in class. This is a fun example of the power of opportunistic data mining aka [http://researchparasite.com/ "research parasitism"] in biomedical research | * [http://www.marcottelab.org/paper-pdfs/PNAS_Phenologs_2010.pdf Phenologs] and the [http://www.marcottelab.org/paper-pdfs/PLoSBiology_TBZ_2012.pdf drug discovery story] (the mechanism of action is [https://doi.org/10.1093/genetics/iyab101 described here]) that we'll discuss in class. This is a fun example of the power of opportunistic data mining aka [http://researchparasite.com/ "research parasitism"] in biomedical research. | ||
Tools for finding orthologs:<br> | Tools for finding orthologs:<br> | ||
* One good tool for discovering orthologs is [https://inparanoidb.sbc.su.se/ InParanoid]. Note: InParanoid annotation lags a bit, so you'll need to find the [http://www.ensembl.org/index.html Ensembl] protein id, or try a text search for the common name. Or, just link there from [http://www.uniprot.org/ Uniprot]. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include [http://omabrowser.org/oma/home/ OMA] (introduced in [http://www.marcottelab.org/users/BCH394P_364C_2025/OMA.pdf this paper]), [http://phylomedb.org/ PhylomeDB], and [http://eggnogdb.embl.de/#/app/home EggNOG]. The various algorithms basically have different trade-offs of precision, recall, and ease of use. For example, we use EggNOG in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in. | * One good tool for discovering orthologs is [https://inparanoidb.sbc.su.se/ InParanoid]. Note: InParanoid annotation lags a bit, so you'll need to find the [http://www.ensembl.org/index.html Ensembl] protein id, or try a text search for the common name. Or, just link there from [http://www.uniprot.org/ Uniprot]. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include [http://omabrowser.org/oma/home/ OMA] (introduced in [http://www.marcottelab.org/users/BCH394P_364C_2025/OMA.pdf this paper]), [http://phylomedb.org/ PhylomeDB], and [http://eggnogdb.embl.de/#/app/home EggNOG]. The various algorithms basically have different trade-offs of precision, recall, and ease of use. For example, we use EggNOG v5.0 in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in (and v5.0 is better-behaved than v6.0 for many genes we care about). | ||
* All (well, at least some) of [http://www.marcottelab.org/users/BCH394P_364C_2025/Sonnhammer2002TiG.pdf your ortholog definition questions answered!] | * All (well, at least some) of [http://www.marcottelab.org/users/BCH394P_364C_2025/Sonnhammer2002TiG.pdf your ortholog definition questions answered!] | ||
* A nice paper about selecting good research problems. [http://www.marcottelab.org/users/BCH394P_364C_2025/ChoosingAProblemInScienceAndEngineering.pdf Here's the pdf]. | * A nice paper about selecting good research problems. [http://www.marcottelab.org/users/BCH394P_364C_2025/ChoosingAProblemInScienceAndEngineering.pdf Here's the pdf]. | ||
'''Apr 8, 2025 - Computational Protein Design''' | '''Apr 8, 2025 - Computational Protein Design''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/ComputationalProteinDesign_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/ComputationalProteinDesign_Spring2025.pdf Today's slides] | ||
| Line 63: | Line 62: | ||
* Try it yourself! Here's the [https://colab.research.google.com/github/sokrypton/ColabDesign/blob/main/rf/examples/diffusion.ipynb RFDiffusion + ProteinMPNN colab notebook for protein backbone + sequence design], [https://huggingface.co/spaces/simonduerr/ProteinMPNN a site for running ProteinMPNN in isolation for protein sequence redesign], and [https://colab.research.google.com/github/ullahsamee/ligandMPNN_Colab/blob/main/LigandMPNN_Colab.ipynb the LigandMPNN colab notebook for small-molecule award protein sequence redesign]. | * Try it yourself! Here's the [https://colab.research.google.com/github/sokrypton/ColabDesign/blob/main/rf/examples/diffusion.ipynb RFDiffusion + ProteinMPNN colab notebook for protein backbone + sequence design], [https://huggingface.co/spaces/simonduerr/ProteinMPNN a site for running ProteinMPNN in isolation for protein sequence redesign], and [https://colab.research.google.com/github/ullahsamee/ligandMPNN_Colab/blob/main/LigandMPNN_Colab.ipynb the LigandMPNN colab notebook for small-molecule award protein sequence redesign]. | ||
'''Apr 3, 2025 - Large Language Models in Biology''' | '''Apr 3, 2025 - Large Language Models in Biology''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/ | * [http://www.marcottelab.org/users/BCH394P_364C_2025/2025-04-03_AaronFeller_TeachingLanguageModelstoSpeakBiology.pptx Today's slides] | ||
* [https://www.linkedin.com/in/aaronleefeller/ Aaron Feller]. Aaron is a computational biologist and PhD student in | * Guest speaker: [https://www.linkedin.com/in/aaronleefeller/ Aaron Feller]. Aaron is a computational biologist and PhD student in the Wilke lab specializing in large language models. He will be providing a conceptual basis for how LLMs work and are applied to biological datasets. | ||
'''Apr 1, 2025 - 3D Protein Structure Modeling with AlphaFold & ChimeraX''' | '''Apr 1, 2025 - 3D Protein Structure Modeling with AlphaFold & ChimeraX''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/ | * [http://www.marcottelab.org/users/BCH394P_364C_2025/ProteinStructPredict_Bioinformatics_Apr1_2025.pdf Today's slides] | ||
* Guest speaker: [https://www.linkedin.com/in/darylrbarth/ Daryl Barth]. Daryl is a computational synthetic biologist and PhD student in our program doing active research in computational protein structure prediction and design, with a focus on developing new-to-nature enzyme catalysts. She will talk about the use of techniques like AlphaFold and RosettaFold for protein 3D structure modeling and prediction. | * Guest speaker: [https://www.linkedin.com/in/darylrbarth/ Daryl Barth]. Daryl is a computational synthetic biologist and PhD student in our program doing active research in computational protein structure prediction and design, with a focus on developing [https://www.kungfu.ai/videos/episode-12-tackling-plastic-pollution-with-ai-predicted-protein-folding new-to-nature enzyme catalysts]. She will talk about the use of techniques like AlphaFold and RosettaFold for protein 3D structure modeling and prediction. | ||
* 3D macromolecular structural modeling software: [https://www.cgl.ucsf.edu/chimerax/ UCSF ChimeraX], the [https://www.rosettacommons.org/software Rosetta] software suite, and [http://www.marcottelab.org/users/BCH394P_364C_2025/RosettaReview.pdf an overview] of what it can do for you, and last but not least: [https://alphafold.ebi.ac.uk/ AlphaFold predicted structures] and the [https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb AlphaFold colab] where you can run your own structure predictions. | * 3D macromolecular structural modeling software: [https://www.cgl.ucsf.edu/chimerax/ UCSF ChimeraX], the [https://www.rosettacommons.org/software Rosetta] software suite, and [http://www.marcottelab.org/users/BCH394P_364C_2025/RosettaReview.pdf an overview] of what it can do for you, and last but not least: [https://alphafold.ebi.ac.uk/ AlphaFold predicted structures] and the [https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb AlphaFold colab] where you can run your own structure predictions. | ||
* & a few other useful 3D structure tools: The [http://www.rcsb.org/ Protein Data Bank], [https://salilab.org/modeller/ MODELLER], and [http://www.pymol.org/ Pymol] | * & a few other useful 3D structure tools: The [http://www.rcsb.org/ Protein Data Bank], [https://salilab.org/modeller/ MODELLER], and [http://www.pymol.org/ Pymol] | ||
* There is a nice tutorial on using AlphaFold and ChimeraX from EMBL/DFG (Kosinski group) available [https://docs.google.com/document/d/1_g1_M-I40CqOQc5obwAt08YntC5D2Z_WNz6mYuUQtyc/edit#heading=h.m7ei2f72v2ig here]. | * There is a nice tutorial on using AlphaFold and ChimeraX from EMBL/DFG (Kosinski group) available [https://docs.google.com/document/d/1_g1_M-I40CqOQc5obwAt08YntC5D2Z_WNz6mYuUQtyc/edit#heading=h.m7ei2f72v2ig here]. | ||
'''Mar 27, 2025 - Principal Component Analysis (& the curious case of European genotypes)''' | '''Mar 27, 2025 - Principal Component Analysis (& the curious case of European genotypes)''' | ||
* We'll quickly wrap up the slides from last time, then move on to... | |||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_PCA_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_PCA_Spring2025.pdf Today's slides] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/EuropeanGenesPCA.pdf European men, their genomes, and their geography] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/EuropeanGenesPCA.pdf European men, their genomes, and their geography] | ||
| Line 87: | Line 87: | ||
* Science Signaling (more specifically, Neil R. Clark and Avi Ma’ayan!) had a nice introduction to PCA that I've reposted [http://www.marcottelab.org/users/BCH394P_364C_2025/IntroToPCA.pdf here] (with [http://www.marcottelab.org/users/BCH394P_364C_2025/2001967Slides-FINAL.ppt slides]) | * Science Signaling (more specifically, Neil R. Clark and Avi Ma’ayan!) had a nice introduction to PCA that I've reposted [http://www.marcottelab.org/users/BCH394P_364C_2025/IntroToPCA.pdf here] (with [http://www.marcottelab.org/users/BCH394P_364C_2025/2001967Slides-FINAL.ppt slides]) | ||
* Python code for [http://sebastianraschka.com/Articles/2015_pca_in_3_steps.html performing PCA yourself]. This example gives a great intro to several important numerical/statistical/data mining packages in Python, including pandas and numpy. | * Python code for [http://sebastianraschka.com/Articles/2015_pca_in_3_steps.html performing PCA yourself]. This example gives a great intro to several important numerical/statistical/data mining packages in Python, including pandas and numpy. | ||
'''Mar 25, 2025 - Classifiers''' | '''Mar 25, 2025 - Classifiers''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P_364C_Classifiers_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P_364C_Classifiers_Spring2025.pdf Today's slides] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/MachineLearningReview.pdf A nice review explaining Support Vector Machines and k-NN classifiers] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/MachineLearningReview.pdf A nice review explaining Support Vector Machines and k-NN classifiers] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/AMLALLclassification.pdf Classifying leukemias], and [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6036716/ a 2018 review] and [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8000474/ 2021 review] of how that field has led to commercial cancer diagnostics, such as the Prosigna breast cancer diagnostic. If you're curious, the authors of the AMLALL classification paper [http://www.marcottelab.org/users/BCH394P_364C_2025/LanderGolubPatentOnExpressionClassification.pdf patented their approach] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/AMLALLclassification.pdf Classifying leukemias], and [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6036716/ a 2018 review] and [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8000474/ 2021 review] of how that field has led to commercial cancer diagnostics, such as the Prosigna breast cancer diagnostic. If you're curious, the authors of the AMLALL classification paper [http://www.marcottelab.org/users/BCH394P_364C_2025/LanderGolubPatentOnExpressionClassification.pdf patented their approach] | ||
* For those of you interesting in trying out classifiers on your own, here's the best stand-alone open software for do-it-yourself classifiers and data mining: [http://www.cs.waikato.ac.nz/ml/weka/ Weka]. There is a great introduction to using Weka in this book chapter [http://link.springer.com/protocol/10.1007/978-1-4939-3578-9_17 Introducing Machine Learning Concepts with WEKA], as well as the very accessible Weka-produced book [ | * For those of you interesting in trying out classifiers on your own, here's the best stand-alone open software for do-it-yourself classifiers and data mining: [http://www.cs.waikato.ac.nz/ml/weka/ Weka]. There is a great introduction to using Weka in this book chapter [http://link.springer.com/protocol/10.1007/978-1-4939-3578-9_17 Introducing Machine Learning Concepts with WEKA], as well as the very accessible Weka-produced book [https://ml.cms.waikato.ac.nz/weka/book.html Data Mining: Practical Machine Learning Tools and Techniques]. | ||
* & to do this directly in Python, there's a really excellent library of simple, easy-to-use, classification, regression, machine learning and data mining tools called [https://scikit-learn.org/stable/ scikit-learn]. I highly recommend using scikit-learn in combination with the [https://pandas.pydata.org/ pandas library], which makes it easy to work with large, tabular datasets. Here's [https://www.youtube.com/watch?v=PcvsOaixUh8 a helpful pandas tutorial] to get you started. | * & to do this directly in Python, there's a really excellent library of simple, easy-to-use, classification, regression, machine learning and data mining tools called [https://scikit-learn.org/stable/ scikit-learn]. I highly recommend using scikit-learn in combination with the [https://pandas.pydata.org/ pandas library], which makes it easy to work with large, tabular datasets. Here's [https://www.youtube.com/watch?v=PcvsOaixUh8 a helpful pandas tutorial] to get you started. | ||
'''Mar 24, 2025 - Welcome back from spring break!''' | |||
* Reminder that '''Problem Set 3 is due before 10PM tonight'''. | |||
'''Mar 18,20, 2025 - SPRING BREAK''' | '''Mar 18,20, 2025 - SPRING BREAK''' | ||
'''Mar 13, 2025 - Clustering II''' | '''Mar 13, 2025 - Omics & Data Mining - Clustering II''' | ||
* We'll be continuing the slides from last time | * We'll be continuing the slides from last time | ||
Reading: | Reading: | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/tSNE.pdf t-SNE] and [https://umap-learn.readthedocs.io/en/latest/how_umap_works.html UMAP], and [https://pair-code.github.io/understanding-umap/ an intuitive explanation of the methods]. BUT: [https:// | * [http://www.marcottelab.org/users/BCH394P_364C_2025/tSNE.pdf t-SNE] and [https://umap-learn.readthedocs.io/en/latest/how_umap_works.html UMAP], and [https://pair-code.github.io/understanding-umap/ an intuitive explanation of the methods]. BUT: [https://doi.org/10.1371/journal.pcbi.1011288 here's a strong criticism and very compelling reasons] against relying exclusively on these methods for drawing conclusions about your data. | ||
** Links to various applications of t-SNE: [https://en.wikipedia.org/wiki/T-distributed_stochastic_neighbor_embedding 1], [http://lvdmaaten.github.io/tsne/ 2], [https://www.youtube.com/watch?v=RJVL80Gg3lA 3], [http://distill.pub/2016/misread-tsne/ 4]. You can run t-SNE and UMAP on the [http://projector.tensorflow.org/ following web site]. | ** Links to various applications of t-SNE: [https://en.wikipedia.org/wiki/T-distributed_stochastic_neighbor_embedding 1], [http://lvdmaaten.github.io/tsne/ 2], [https://www.youtube.com/watch?v=RJVL80Gg3lA 3], [http://distill.pub/2016/misread-tsne/ 4]. You can run t-SNE and UMAP on the [http://projector.tensorflow.org/ following web site]. | ||
** Links to various applications of SOMs: [http://en.wikipedia.org/wiki/Self-organizing_map 1], [http://vizier.u-strasbg.fr/kohonen.htx 2], [http://wn.com/Self_Organizing_Maps_Application 3]. You can run SOM clustering with the [http://bonsai.hgc.jp/~mdehoon/software/cluster Open Source Clustering package] with the '-s' option, or GUI option (here's the [http://bonsai.hgc.jp/~mdehoon/software/cluster/manual/SOM.html#SOM manual]). (FYI, it also supports PCA). If you are not happy with Cluster's SOM function, the statistical package R also provides a package for calculating SOMs (http://cran.r-project.org/web/packages/som/index.html). | ** Links to various applications of SOMs: [http://en.wikipedia.org/wiki/Self-organizing_map 1], [http://vizier.u-strasbg.fr/kohonen.htx 2], [http://wn.com/Self_Organizing_Maps_Application 3]. You can run SOM clustering with the [http://bonsai.hgc.jp/~mdehoon/software/cluster Open Source Clustering package] with the '-s' option, or GUI option (here's the [http://bonsai.hgc.jp/~mdehoon/software/cluster/manual/SOM.html#SOM manual]). (FYI, it also supports PCA). If you are not happy with Cluster's SOM function, the statistical package R also provides a package for calculating SOMs (http://cran.r-project.org/web/packages/som/index.html). | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/nature_review_2000.pdf Review of phylogenetic profiles] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/nature_review_2000.pdf Review of phylogenetic profiles] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/FuzzyK-Means.pdf Fuzzy k-means] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/FuzzyK-Means.pdf Fuzzy k-means] | ||
'''Mar 11, 2025 - | '''Mar 11, 2025 - Omics & Data Mining - Clustering I''' | ||
* Don't forget to turn in the proposal for your course project by '''March 12'''. | * Don't forget to turn in the proposal for your course project by '''March 12'''. | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P_364C_LargeScaleExperiments_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P_364C_LargeScaleExperiments_Spring2025.pdf Today's slides] | ||
| Line 127: | Line 127: | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/NBTPrimer-MicroarrayClustering.pdf Primer on clustering] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/NBTPrimer-MicroarrayClustering.pdf Primer on clustering] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/K-means-Example.ppt K-means example (.ppt)] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/K-means-Example.ppt K-means example (.ppt)] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/Bcelllymphoma.pdf B cell lymphomas] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/Bcelllymphoma.pdf B cell lymphomas] | ||
* [http://en.wikipedia.org/wiki/RNA-Seq RNA-Seq] | * [http://en.wikipedia.org/wiki/RNA-Seq RNA-Seq] | ||
'''Mar 6, 2025 - Genome Assembly/Mapping II'''<br> | |||
''' | |||
* We're finishing up the slides from last time. Note that we give short shrift to read mapping/alignment algorithms, of which there are now [https://en.wikipedia.org/wiki/List_of_sequence_alignment_software#Short-Read_Sequence_Alignment a very long list]. Here's an interesting discussion by Lior Pachter of the [https://liorpachter.wordpress.com/2015/11/01/what-is-a-read-mapping/ major developments in that field.] | * We're finishing up the slides from last time. Note that we give short shrift to read mapping/alignment algorithms, of which there are now [https://en.wikipedia.org/wiki/List_of_sequence_alignment_software#Short-Read_Sequence_Alignment a very long list]. Here's an interesting discussion by Lior Pachter of the [https://liorpachter.wordpress.com/2015/11/01/what-is-a-read-mapping/ major developments in that field.] | ||
* Here is [https://web.archive.org/web/20221208084304/http://blog.thegrandlocus.com/2016/07/a-tutorial-on-burrows-wheeler-indexing-methods an excellent explanation (now archived) of how the BWT relates to a suffix tree and enables fast read mapping to a genome] | * Here is [https://web.archive.org/web/20221208084304/http://blog.thegrandlocus.com/2016/07/a-tutorial-on-burrows-wheeler-indexing-methods an excellent explanation (now archived) of how the BWT relates to a suffix tree and enables fast read mapping to a genome] | ||
| Line 156: | Line 139: | ||
* Two notable advances in genome assembly: [http://www.marcottelab.org/users/BCH394P_364C_2025/StringGraphAssembly.pdf String Graphs] and more recently, [http://www.marcottelab.org/users/BCH394P_364C_2025/MultiplexDeBruijnGraphs.pdf multiplexed De Bruijn graphs]. Both have been used to assemble a [http://www.marcottelab.org/users/BCH394P_364C_2025/CompleteHumanGenomeSequence.pdf fully complete human genome sequence] (check out the [https://www.biorxiv.org/content/biorxiv/early/2021/05/27/2021.05.26.445798/F2.large.jpg?width=800&height=600&carousel=1 beautiful string graph visualizations] of the final assemblies, which capture gapless telomere-to-telomere assemblies for all 22 human autosomes and Chromosome X) | * Two notable advances in genome assembly: [http://www.marcottelab.org/users/BCH394P_364C_2025/StringGraphAssembly.pdf String Graphs] and more recently, [http://www.marcottelab.org/users/BCH394P_364C_2025/MultiplexDeBruijnGraphs.pdf multiplexed De Bruijn graphs]. Both have been used to assemble a [http://www.marcottelab.org/users/BCH394P_364C_2025/CompleteHumanGenomeSequence.pdf fully complete human genome sequence] (check out the [https://www.biorxiv.org/content/biorxiv/early/2021/05/27/2021.05.26.445798/F2.large.jpg?width=800&height=600&carousel=1 beautiful string graph visualizations] of the final assemblies, which capture gapless telomere-to-telomere assemblies for all 22 human autosomes and Chromosome X) | ||
* k-mer-based RNA quantification offers [https://www.nature.com/articles/nbt.3519 near-optimal probabilistic RNA-seq quantification]. Here's [https://bioinfo.iric.ca/understanding-how-kallisto-works/ how the program kallisto works] | * k-mer-based RNA quantification offers [https://www.nature.com/articles/nbt.3519 near-optimal probabilistic RNA-seq quantification]. Here's [https://bioinfo.iric.ca/understanding-how-kallisto-works/ how the program kallisto works] | ||
-- | * The key idea of fast binary searches of a giant dataset by building a suffix index is used in many other contexts, including autocomplete and spellchecking. It's hard to track down exactly which algorithms are used by commercial software packages such as MS Word and gmail, but here's [https://dev.to/khald/autocomplete-algorithms-1pb2 a detailed description of how this approach might work in general]. | ||
'''Mar 4, 2025 - Genome Assembly - I''' | |||
''' | * REMINDER: '''Due March 12 by email to the TA+Instructor''' - One to two (full) paragraphs describing your plans for a final project, along with the names of your collaborators. | ||
* | |||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C-GenomeAssembly_Spring2025.pdf Today's slides] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C-GenomeAssembly_Spring2025.pdf Today's slides] | ||
* | * If you're curious, the human genome project, which launched thousands of drug and disease discoveries, was primarily funded in the US by the NIH and DOE. The DOE has some information about it [https://doe-humangenomeproject.ornl.gov/human-genome-project-budget/ here] | ||
* Relevant to the last lecture, some definitions of [https://en.wikipedia.org/wiki/Sensitivity_and_specificity sensitivity/specificity] & [https://en.wikipedia.org/wiki/Precision_and_recall precision/recall]. Note that the gene finding community settled early on to a different definition of specificity that corresponds to the precision or PPV in other fields. Other fields define specificity as the true negative rate. | * Relevant to the last lecture, some definitions of [https://en.wikipedia.org/wiki/Sensitivity_and_specificity sensitivity/specificity] & [https://en.wikipedia.org/wiki/Precision_and_recall precision/recall]. Note that the gene finding community settled early on to a different definition of specificity that corresponds to the precision or PPV in other fields. Other fields define specificity as the true negative rate. | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/DeBruijnPrimer.pdf DeBruijn Primer] and [http://www.marcottelab.org/users/BCH394P_364C_2025/DeBruijnSupplement.pdf Supplement] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/DeBruijnPrimer.pdf DeBruijn Primer] and [http://www.marcottelab.org/users/BCH394P_364C_2025/DeBruijnSupplement.pdf Supplement] | ||
-- | |||
'''Feb 27, 2025 - NGS analysis best practices''' | |||
'''Feb | * Guest speaker: [https://www.researchgate.net/profile/Anna-Battenhouse Anna Battenhouse] from the [https://research.utexas.edu/cbrs/ Center for Biomedical Research Support], where she maintains the [https://wikis.utexas.edu/display/RCTFusers Biomedical Research Computing Facility]. | ||
* We'll | * [http://www.marcottelab.org/users/BCH394P_364C_2025/2025-02-NGS_IntroForEdM.pdf Today's slides] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_Motifs_Spring2025.pdf Today's slides] | |||
* We're introducing methods focused on discovering position weight matrices using Gibbs Sampling, but there are | |||
'''Feb 25, 2025 - Motifs''' | |||
* Homework #3 (worth 10% of your final course grade) has been assigned on Rosalind and is '''due by 10:00PM March 5'''. In past years, we've run into problems with Rosalind timing out before Meme completes although it usually runs eventually, so be warned you may have to try it a couple of times. Meme runs faster using the "zero to one" or "one" occurrence per sequence option, rather than the "any number of repeats" option. Ultimately, if you can't get it to work, just paste the input sequences + Meme output into a single file and submit that through Canvas, and we'll give you credit for it. | |||
* '''Due March 12 by email to the TA+Instructor''' - One to two (full) paragraphs describing your plans for a final project, along with the names of your collaborators. Please limit to no more than 3 per group, please. It's also fine to do this independently, if you prefer. (Do you have a particular skill/interest/exciting dataset you need help analyzing? We'll spend a few minutes at the start of class asking around for partners.) This assignment (planning out your project) will account for 5 points out of your 25 total points for your course project. Here are a few examples of final projects from previous years: [https://sites.google.com/view/bioinformaticsproject/introduction-and-goals?authuser=0 1] [https://sites.google.com/view/bch394ssy/home 2] [https://sites.google.com/view/bch394p-project/home 3] [https://sites.google.com/view/subcellularloc/projects 4] [https://sites.google.com/utexas.edu/voigt-final-project/home?authuser=0 5] [https://sites.google.com/utexas.edu/oishika-das-bioinformatics-pro/home 6] [https://sites.google.com/view/ama1-polymorphism/home?authuser=0 7] [https://sites.google.com/view/bch-364c-final-project/home?authuser=0 8] [https://metabolicnetworkpathways.wordpress.com/ 9]. Remember that the project itself will ultimately be due one month later on April 16 (& '''late days can't be used for the final project'''.)<br> | |||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_Motifs_Spring2025.pdf Today's slides.] We'll talk about motif finding today. | |||
* We're introducing methods focused on discovering position weight matrices using Gibbs Sampling, but there are [http://www.marcottelab.org/users/BCH394P_364C_2025/DeepNN-MotifFinders-2020Review.pdf interesting developments using deep neural networks too] | |||
* Here's a [https://www.biorxiv.org/content/10.1101/2024.01.12.574168v2.full recent bioRxiv preprint] bench-marking the major motif-finding algorithms. They particularly recommended DEME, Opal, and SLiMFinder. DEME and Opal seem a bit harder to access, but SLiMFinder can be run through a [http://www.slimsuite.unsw.edu.au/servers/slimfinder.php web server] (also accessible [http://slim.icr.ac.uk/tools/peptools/input here]). | * Here's a [https://www.biorxiv.org/content/10.1101/2024.01.12.574168v2.full recent bioRxiv preprint] bench-marking the major motif-finding algorithms. They particularly recommended DEME, Opal, and SLiMFinder. DEME and Opal seem a bit harder to access, but SLiMFinder can be run through a [http://www.slimsuite.unsw.edu.au/servers/slimfinder.php web server] (also accessible [http://slim.icr.ac.uk/tools/peptools/input here]). | ||
* Wordle as an excuse to learn about [https://www.youtube.com/watch?v=v68zYyaEmEA information theory & entropy] and [https://www.youtube.com/watch?v=OvTriQWQvUg sequence logos and motifs]! | * Wordle as an excuse to learn about [https://www.youtube.com/watch?v=v68zYyaEmEA information theory & entropy] and [https://www.youtube.com/watch?v=OvTriQWQvUg sequence logos and motifs]! | ||
| Line 180: | Line 166: | ||
* [http://www.rcsb.org/pdb/explore/explore.do?structureId=1L1M The biochemical basis of a particular motif] | * [http://www.rcsb.org/pdb/explore/explore.do?structureId=1L1M The biochemical basis of a particular motif] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/GibbsSampling.pdf Gibbs Sampling] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/GibbsSampling.pdf Gibbs Sampling] | ||
'''Feb 20, 2025 - Gene finding II''' | '''Feb 20, 2025 - Gene finding II''' | ||
* We're finishing up the slides from last time. | * We're finishing up the slides from last time. | ||
* Science news of the day: [https://arcinstitute.org/manuscripts/Evo2 New neural network models (Evo2)] trained to model genome architecture can capture (to varying extents) a number of the functional elements of chromosomes. Relevant to gene-finding, it appears to recognize human exons with an accuracy corresponding to ~0.82 area under a ROC curve (AUROC), so considerably better than random (AUROC=0.5) but definitely not perfectly (AUROC=1.0). | |||
* | * Regarding the difficulties finding short genes: [https://www.cell.com/molecular-cell/fulltext/S1097-2765(23)00075-8 New evidence for very short human ORFs coding for real microproteins & peptides] | ||
'''Feb 18, 2025 - Gene finding''' | '''Feb 18, 2025 - Gene finding''' | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C-GeneFinding-Spring2025.pdf Today's slides on gene finding] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C-GeneFinding-Spring2025.pdf Today's slides on gene finding] | ||
* A nice commentary on gene finding: [http://www.marcottelab.org/users/BCH394P_364C_2025/2019StateOfGeneAnnotation.pdf Next-generation genome annotation: we still struggle to get it right] | * A nice commentary on gene finding: [http://www.marcottelab.org/users/BCH394P_364C_2025/2019StateOfGeneAnnotation.pdf Next-generation genome annotation: we still struggle to get it right] | ||
* For a few more examples of HMMs in action, here's a [http://www.marcottelab.org/users/BCH394P_364C_2025/MinionHumanGenome.pdf paper on sequencing the human genome by nanopore], which used HMMs in 3-4 different ways for polishing, contig inspection, repeat analysis and 5-methylcytosine detection. Note the use of AUGUSTUS to annotate genes, relevant to | * For a few more examples of HMMs in action, here's a [http://www.marcottelab.org/users/BCH394P_364C_2025/MinionHumanGenome.pdf paper on sequencing the human genome by nanopore], which used HMMs in 3-4 different ways for polishing, contig inspection, repeat analysis and 5-methylcytosine detection. Note the use of AUGUSTUS to annotate genes, relevant to today's lecture. | ||
* [ | * [https://genome.ucsc.edu/cgi-bin/hgGateway The UCSC genome browser] | ||
* A few useful links about programming: [http://www.marcottelab.org/users/BCH394P_364C_2025/GoodEnoughPracticesInScientificComputing.pdf Recommendations for "good enough" programming habits] and a great [https://www.youtube.com/playlist?list=PL-osiE80TeTskrapNbzXhwoFUiLCjGgY7 Python beginners Youtube tutorial] | * A few useful links about programming: [http://www.marcottelab.org/users/BCH394P_364C_2025/GoodEnoughPracticesInScientificComputing.pdf Recommendations for "good enough" programming habits] and a great [https://www.youtube.com/playlist?list=PL-osiE80TeTskrapNbzXhwoFUiLCjGgY7 Python beginners Youtube tutorial] | ||
* Some recommendations for gene finding in euks ([https://genome.cshlp.org/content/34/5/769 Braker3]) and proks ([https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-119 Prodigal]) | |||
Reading (a couple of old classics + a review + better splice site detection):<br> | Reading (a couple of old classics + a review + better splice site detection):<br> | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/EukGeneAnnotation.pdf Eukaryotic gene finding], [http://www.marcottelab.org/users/BCH394P_364C_2025/GeneMark.hmm.pdf GeneMark.hmm], and [http://www.marcottelab.org/users/BCH394P_364C_2025/BurgeKarlin-main.pdf GENSCAN] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/EukGeneAnnotation.pdf Eukaryotic gene finding], [http://www.marcottelab.org/users/BCH394P_364C_2025/GeneMark.hmm.pdf GeneMark.hmm], and [http://www.marcottelab.org/users/BCH394P_364C_2025/BurgeKarlin-main.pdf GENSCAN] | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/SplicingAI-jaganathan2019.pdf Deep learning for splice set identification] | * [http://www.marcottelab.org/users/BCH394P_364C_2025/SplicingAI-jaganathan2019.pdf Deep learning for splice set identification] | ||
'''Feb 13, 2025 - HMMs II''' | '''Feb 13, 2025 - HMMs II''' | ||
* We'll be finishing up slides from last time. | * We'll be finishing up slides from last time. | ||
* There were some issues with Rosalind stopping early last night, so I've reopened it and extended the deadline for the homework until 10PM tonight. | |||
'''Problem Set 2, due before 10 PM, Feb. 24, 2025''':<br> | '''Problem Set 2, due before 10 PM, Feb. 24, 2025''':<br> | ||
* [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_ProblemSet2_Spring2025.pdf '''Problem Set 2''']. | * [http://www.marcottelab.org/users/BCH394P_364C_2025/BCH394P-364C_ProblemSet2_Spring2025.pdf '''Problem Set 2''']. | ||
| Line 209: | Line 197: | ||
--> | --> | ||
* Link to [http://setosa.io/blog/2014/07/26/markov-chains/ a great interactive visualization of Markov chains], by Victor Powell & Lewis Lehe. It's worth checking out to build some intuition. They correctly point out that [https://en.wikipedia.org/wiki/PageRank Google's PageRank algorithm] is based on Markov chains. There, the ranking of pages in a web search relates to how random walks across linked web pages spend more time on some pages than on others. | * Link to [http://setosa.io/blog/2014/07/26/markov-chains/ a great interactive visualization of Markov chains], by Victor Powell & Lewis Lehe. It's worth checking out to build some intuition. They correctly point out that [https://en.wikipedia.org/wiki/PageRank Google's PageRank algorithm] is based on Markov chains. There, the ranking of pages in a web search relates to how random walks across linked web pages spend more time on some pages than on others. | ||
* A non-biological example of using log odds ratios & Bayesian stats [https://priceonomics.com/how-statistics-solved-a-175-year-old-mystery-about/ to learn the authors of the Federalist Papers]. In a related example, | * A non-biological example of using log odds ratios & Bayesian stats [https://priceonomics.com/how-statistics-solved-a-175-year-old-mystery-about/ to learn the authors] of the [https://en.wikipedia.org/wiki/The_Federalist_Papers Federalist Papers]. In a related example, researchers decoded >50 coded letters from a French archive and discovered they were lost correspondence from Mary, Queen of Scots, before she was executed in 1587 for treason against Elizabeth I. The researchers used an approach closely related to computing log odds ratios of 5-mer frequencies between putative decoded texts and known free text to figure out the correct ciphers. If you're curious, you can read about it in [https://www.tandfonline.com/doi/full/10.1080/01611194.2022.2160677 Appendix A of their paper] | ||
Latest revision as of 14:56, 17 April 2025
BCH394P/BCH364C Systems Biology & Bioinformatics
Course unique #: 54960/54860
Lectures: Tues/Thurs 9:30 – 11:00 AM WEL 2.246
Instructor: Edward Marcotte, marcotte @ utexas.edu
- Office hours: Mon 4 – 5 PM on the class Zoom channel (available on Canvas)
TA: Zoya Ansari, zansari @ utexas.edu
- TA Office hours: Tues 1 - 2 PM / Fri 1 - 2 PM in MBB 3.304 or by appointment on Zoom
Class Canvas site: https://utexas.instructure.com/courses/1407802
Lectures & Handouts
Apr 17 - 24, 2025 - Final Project Presentations
- Welcome to the end of the course! You made it! The last 3 days will be presentations of your class projects.
- Please don't forget to do the Course - Instructor Survey on Canvas!
Here's a sampling of some of the completed course projects (posted with permission):
- picocell, a protein-language model guided simulation of cellular evolution, by Ira Zibbu
- Motif Orientation and Characterization for High-throughput Assays (MOCHA), by Collin Andrews and Anjana Ram
- Bioinformatics Analysis of SPHK1 Mutations in Prostate Cancer, by Akankshya Satapathy, Mairepaiti Halimulati, Tatiana Guaraca
- Decoding Virus-Activated Micropeptides in lncRNAs, by Anik Mojumder
- MLO-A5 Tag-Sec Data Analysis, by Han Ding
- Sex-specific Regulatory Elements on Genes Involved in Feeding and Energy Expenditure, by Ziyi Xu
- Barcoded amplicon reads: consensus Generation and organized demultiplexing engineered for you, by Mohammadreza Mojoudi and Sabranth Gupta
- Metabolic Profiling to Explore the Effects of GLS1 Inhibition by CB-839 and its Structural Mechanism, by Sukyoung Choi, Yujin Lee, Kangsan Kim
- Predicting Site-Specific Nitrite Modification of Heme Proteins Using Machine Learning, by Laura Ekeleme
- PDAC Prediction with a Urine Biomarker Penal, by Yujie (Janet) He
- Comparative Analysis of Pseudouridine (Ψ) Detection in PM-Exposed Lung Cells: Nanopore Direct RNA Sequencing vs. BID‑Seq, by Morgan Stephens
- Mining and Classifying Antimicrobial Peptides (AMPs), by Akul Saxena
April 15, 2025 - Synthetic Biology, highly compressed
- Reminder: All projects are due by 10PM, April 16. Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR.
- Today's slides
- Reminder that the CBRS is offering short (1 day) courses on computational bio topics, including stats modeling, unix/linux, bash scripting, and more
- TACC is hosting TACC Institute - Machine Learning for Life Sciences Research, an "immersive dive into machine learning best practices and applications in life sciences" from May 19-23
- Food for thought: Colossal.com, a fairly nuanced report of their recent progress on the dire wolf, and criticism of characterizing it as de-extinction
A collection of further reading, if you're so inclined:
- Genome Transplantation
- A new cell from a chemically synthesized genome
- Minimal Mycoplasma
- Synthetic E. coli genome
- Synthetic Yeast: Sc2.0
- Sc 2.0 computational genome design
- Take your own coliroids
- The infamous repressilator
- Bacterial photography
- Edge detector
April 10, 2025 - A case study in using bioinformatics and public data to make new discoveries (Orthologs, Paralogs, and Phenologs)
- Remember: The final project web page is due by 10PM April 16, 2025, turned in as a URL emailed to the TA+Professor. Please indicate in the email if you are willing to let us post the project to the course web site. Also, note that late days can't be used for the final project
- Today's slides
- Phenologs and the drug discovery story (the mechanism of action is described here) that we'll discuss in class. This is a fun example of the power of opportunistic data mining aka "research parasitism" in biomedical research.
Tools for finding orthologs:
- One good tool for discovering orthologs is InParanoid. Note: InParanoid annotation lags a bit, so you'll need to find the Ensembl protein id, or try a text search for the common name. Or, just link there from Uniprot. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include OMA (introduced in this paper), PhylomeDB, and EggNOG. The various algorithms basically have different trade-offs of precision, recall, and ease of use. For example, we use EggNOG v5.0 in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in (and v5.0 is better-behaved than v6.0 for many genes we care about).
- All (well, at least some) of your ortholog definition questions answered!
- A nice paper about selecting good research problems. Here's the pdf.
Apr 8, 2025 - Computational Protein Design
- Today's slides
- Lots of very good supporting papers today, highly recommended to at least scan and get the high points: ESMFold RosettaFold All-Atom RFDiffusion NBT primer on generative protein design NBT primer on protein language models
- Try it yourself! Here's the RFDiffusion + ProteinMPNN colab notebook for protein backbone + sequence design, a site for running ProteinMPNN in isolation for protein sequence redesign, and the LigandMPNN colab notebook for small-molecule award protein sequence redesign.
Apr 3, 2025 - Large Language Models in Biology
- Today's slides
- Guest speaker: Aaron Feller. Aaron is a computational biologist and PhD student in the Wilke lab specializing in large language models. He will be providing a conceptual basis for how LLMs work and are applied to biological datasets.
Apr 1, 2025 - 3D Protein Structure Modeling with AlphaFold & ChimeraX
- Today's slides
- Guest speaker: Daryl Barth. Daryl is a computational synthetic biologist and PhD student in our program doing active research in computational protein structure prediction and design, with a focus on developing new-to-nature enzyme catalysts. She will talk about the use of techniques like AlphaFold and RosettaFold for protein 3D structure modeling and prediction.
- 3D macromolecular structural modeling software: UCSF ChimeraX, the Rosetta software suite, and an overview of what it can do for you, and last but not least: AlphaFold predicted structures and the AlphaFold colab where you can run your own structure predictions.
- & a few other useful 3D structure tools: The Protein Data Bank, MODELLER, and Pymol
- There is a nice tutorial on using AlphaFold and ChimeraX from EMBL/DFG (Kosinski group) available here.
Mar 27, 2025 - Principal Component Analysis (& the curious case of European genotypes)
- We'll quickly wrap up the slides from last time, then move on to...
- Today's slides
- European men, their genomes, and their geography
- The tSNE interactive visualization tool also performs PCA
- Relevant to today's lecture for his eponymous distance measure: Mahalanobis
A smattering of links on PCA:
- NBT Primer on PCA
- A PCA overview (.docx format) & the original post
- Science Signaling (more specifically, Neil R. Clark and Avi Ma’ayan!) had a nice introduction to PCA that I've reposted here (with slides)
- Python code for performing PCA yourself. This example gives a great intro to several important numerical/statistical/data mining packages in Python, including pandas and numpy.
Mar 25, 2025 - Classifiers
- Today's slides
- A nice review explaining Support Vector Machines and k-NN classifiers
- Classifying leukemias, and a 2018 review and 2021 review of how that field has led to commercial cancer diagnostics, such as the Prosigna breast cancer diagnostic. If you're curious, the authors of the AMLALL classification paper patented their approach
- For those of you interesting in trying out classifiers on your own, here's the best stand-alone open software for do-it-yourself classifiers and data mining: Weka. There is a great introduction to using Weka in this book chapter Introducing Machine Learning Concepts with WEKA, as well as the very accessible Weka-produced book Data Mining: Practical Machine Learning Tools and Techniques.
- & to do this directly in Python, there's a really excellent library of simple, easy-to-use, classification, regression, machine learning and data mining tools called scikit-learn. I highly recommend using scikit-learn in combination with the pandas library, which makes it easy to work with large, tabular datasets. Here's a helpful pandas tutorial to get you started.
Mar 24, 2025 - Welcome back from spring break!
- Reminder that Problem Set 3 is due before 10PM tonight.
Mar 18,20, 2025 - SPRING BREAK
Mar 13, 2025 - Omics & Data Mining - Clustering II
- We'll be continuing the slides from last time
Reading:
- t-SNE and UMAP, and an intuitive explanation of the methods. BUT: here's a strong criticism and very compelling reasons against relying exclusively on these methods for drawing conclusions about your data.
- Links to various applications of t-SNE: 1, 2, 3, 4. You can run t-SNE and UMAP on the following web site.
- Links to various applications of SOMs: 1, 2, 3. You can run SOM clustering with the Open Source Clustering package with the '-s' option, or GUI option (here's the manual). (FYI, it also supports PCA). If you are not happy with Cluster's SOM function, the statistical package R also provides a package for calculating SOMs (http://cran.r-project.org/web/packages/som/index.html).
- Review of phylogenetic profiles
- Fuzzy k-means
Mar 11, 2025 - Omics & Data Mining - Clustering I
- Don't forget to turn in the proposal for your course project by March 12.
- Today's slides
- & the final problem set of the semester: Problem Set 3, due before 10PM Mar. 24, 2025. You will need the following software and datasets:
- The clustering software is available here. There is an alternative package here that you can download and install on your local computer if you prefer.
- Amino acid sequences of 1832 human proteins (Note:a few of these proteins have "U" amino acids, which indicates selenocysteine. You can count it or ignore it, your choice.)
- Human protein phylogenetic profiles. These data come from this paper.
- Human protein co-fractionation/mass spectrometry profiles. These data come from this paper.
Reading:
Mar 6, 2025 - Genome Assembly/Mapping II
- We're finishing up the slides from last time. Note that we give short shrift to read mapping/alignment algorithms, of which there are now a very long list. Here's an interesting discussion by Lior Pachter of the major developments in that field.
- Here is an excellent explanation (now archived) of how the BWT relates to a suffix tree and enables fast read mapping to a genome
- If you want a more detailed explanation, the BWA paper more formally describes how the Burrows–Wheeler transform can be used to construct an index.
- The importance of getting mapping correct: Prominent analyses of cancer microbiomes may suffer from "major, fatal errors in the data and methods"
Supporting reading:
- Two notable advances in genome assembly: String Graphs and more recently, multiplexed De Bruijn graphs. Both have been used to assemble a fully complete human genome sequence (check out the beautiful string graph visualizations of the final assemblies, which capture gapless telomere-to-telomere assemblies for all 22 human autosomes and Chromosome X)
- k-mer-based RNA quantification offers near-optimal probabilistic RNA-seq quantification. Here's how the program kallisto works
- The key idea of fast binary searches of a giant dataset by building a suffix index is used in many other contexts, including autocomplete and spellchecking. It's hard to track down exactly which algorithms are used by commercial software packages such as MS Word and gmail, but here's a detailed description of how this approach might work in general.
Mar 4, 2025 - Genome Assembly - I
- REMINDER: Due March 12 by email to the TA+Instructor - One to two (full) paragraphs describing your plans for a final project, along with the names of your collaborators.
- Today's slides
- If you're curious, the human genome project, which launched thousands of drug and disease discoveries, was primarily funded in the US by the NIH and DOE. The DOE has some information about it here
- Relevant to the last lecture, some definitions of sensitivity/specificity & precision/recall. Note that the gene finding community settled early on to a different definition of specificity that corresponds to the precision or PPV in other fields. Other fields define specificity as the true negative rate.
- DeBruijn Primer and Supplement
Feb 27, 2025 - NGS analysis best practices
- Guest speaker: Anna Battenhouse from the Center for Biomedical Research Support, where she maintains the Biomedical Research Computing Facility.
- Today's slides
Feb 25, 2025 - Motifs
- Homework #3 (worth 10% of your final course grade) has been assigned on Rosalind and is due by 10:00PM March 5. In past years, we've run into problems with Rosalind timing out before Meme completes although it usually runs eventually, so be warned you may have to try it a couple of times. Meme runs faster using the "zero to one" or "one" occurrence per sequence option, rather than the "any number of repeats" option. Ultimately, if you can't get it to work, just paste the input sequences + Meme output into a single file and submit that through Canvas, and we'll give you credit for it.
- Due March 12 by email to the TA+Instructor - One to two (full) paragraphs describing your plans for a final project, along with the names of your collaborators. Please limit to no more than 3 per group, please. It's also fine to do this independently, if you prefer. (Do you have a particular skill/interest/exciting dataset you need help analyzing? We'll spend a few minutes at the start of class asking around for partners.) This assignment (planning out your project) will account for 5 points out of your 25 total points for your course project. Here are a few examples of final projects from previous years: 1 2 3 4 5 6 7 8 9. Remember that the project itself will ultimately be due one month later on April 16 (& late days can't be used for the final project.)
- Today's slides. We'll talk about motif finding today.
- We're introducing methods focused on discovering position weight matrices using Gibbs Sampling, but there are interesting developments using deep neural networks too
- Here's a recent bioRxiv preprint bench-marking the major motif-finding algorithms. They particularly recommended DEME, Opal, and SLiMFinder. DEME and Opal seem a bit harder to access, but SLiMFinder can be run through a web server (also accessible here).
- Wordle as an excuse to learn about information theory & entropy and sequence logos and motifs!
- NBT Primer - What are motifs?
- NBT Primer - How does motif discovery work?
- The biochemical basis of a particular motif
- Gibbs Sampling
Feb 20, 2025 - Gene finding II
- We're finishing up the slides from last time.
- Science news of the day: New neural network models (Evo2) trained to model genome architecture can capture (to varying extents) a number of the functional elements of chromosomes. Relevant to gene-finding, it appears to recognize human exons with an accuracy corresponding to ~0.82 area under a ROC curve (AUROC), so considerably better than random (AUROC=0.5) but definitely not perfectly (AUROC=1.0).
- Regarding the difficulties finding short genes: New evidence for very short human ORFs coding for real microproteins & peptides
Feb 18, 2025 - Gene finding
- Today's slides on gene finding
- A nice commentary on gene finding: Next-generation genome annotation: we still struggle to get it right
- For a few more examples of HMMs in action, here's a paper on sequencing the human genome by nanopore, which used HMMs in 3-4 different ways for polishing, contig inspection, repeat analysis and 5-methylcytosine detection. Note the use of AUGUSTUS to annotate genes, relevant to today's lecture.
- The UCSC genome browser
- A few useful links about programming: Recommendations for "good enough" programming habits and a great Python beginners Youtube tutorial
- Some recommendations for gene finding in euks (Braker3) and proks (Prodigal)
Reading (a couple of old classics + a review + better splice site detection):
Feb 13, 2025 - HMMs II
- We'll be finishing up slides from last time.
- There were some issues with Rosalind stopping early last night, so I've reopened it and extended the deadline for the homework until 10PM tonight.
Problem Set 2, due before 10 PM, Feb. 24, 2025:
- Problem Set 2.
- You'll need these 3 files: State sequences, Soluble sequences, Transmembrane sequences
- If you would like a few examples of proteins with their transmembrane and soluble regions annotated (according to UniProt) to help troubleshoot your homework, here are some example yeast protein sequences.
- Link to a great interactive visualization of Markov chains, by Victor Powell & Lewis Lehe. It's worth checking out to build some intuition. They correctly point out that Google's PageRank algorithm is based on Markov chains. There, the ranking of pages in a web search relates to how random walks across linked web pages spend more time on some pages than on others.
- A non-biological example of using log odds ratios & Bayesian stats to learn the authors of the Federalist Papers. In a related example, researchers decoded >50 coded letters from a French archive and discovered they were lost correspondence from Mary, Queen of Scots, before she was executed in 1587 for treason against Elizabeth I. The researchers used an approach closely related to computing log odds ratios of 5-mer frequencies between putative decoded texts and known free text to figure out the correct ciphers. If you're curious, you can read about it in Appendix A of their paper
Feb 11, 2025 - Hidden Markov Models
- Don't forget: Rosalind Homework #2 (worth 10% of your final course grade) is due by 10 PM February 12.
- More stats for comp biologists worth checking out: Modern Statistic for Modern Biology, by Susan Holmes and Wolfgang Huber. It's currently available online and available on dead tree. (FYI, all code is in R.)
- Today's slides
Reading:
- HMM primer and Bayesian statistics primer #1, Bayesian statistics primer #2, Wiki Bayes
- Care to practice your regular expressions? (In python? & a Python regexp cheat sheet)
Feb 6, 2025 - Biological databases
Homework #2 (worth 10% of your final course grade) has been assigned on Rosalind and is due by 10 PM February 12:
- A reminder for when you turn in code for Rosalind: please copy just the text with your code out of Jupyter and paste/upload that into Rosalind, rather than uploading the .ipynb files (which are not intended to be human readable)
- Besides giving a bit more programming experience, these questions will also give you some more practice with the BioPython Python library (see the "programming shortcuts" at the bottom of several questions). If you have yet to install BioPython on your computer, open an Anaconda prompt window (on a PC) or launch a console window from the Anaconda Navigator & type "pip install biopython". (You can use this approach to install most Python libraries.) There's a very useful tutorial here
- NOTE: The problem titled "Complementing a Strand of DNA" uses a now out-of-date call for IUPAC codes in the Programming Shortcut. Just delete the "from Bio.Alphabet import IUPAC" line & delete the ", IUPAC.unambiguous_dna" portion of the Seq() functions and it will work fine. e.g. all you need is something like this: my_seq = Seq("GATCGATGGGCCTATATAGGATCGAAAATCGC")
Extra reading/classes:
- Just a note that we'll be seeing ever more statistics as go on. Here's a good primer from Prof. Lauren Ancel Myers (who leads the UT Austin COVID-19 Modeling Consortium) to refresh/explain basic concepts.
- Finally, here's great opportunity to hone your Python skills a bit more: The UT CBRS cores will offer short courses in Python, Unix, and Python for Data Sciences starting in March.
- Why we compute multiple hypothesis corrections when searching sequence (and other) databases
Feb 4, 2025 - Speeding up your searches: BLAST, MMSeqs2, and Foldseek
- *** Problem Set #1 is due by 10 PM tomorrow, Feb 5. ***
- Our slides today are modified from a paper on Teaching BLAST by Cheryl Kerfeld & Kathleen Scott.
- The original BLAST paper
- The protein homology graph paper. Just for fun, here's a stylized version of this plot that we exhibited in the engaging Design and the Elastic Mind show at New York's Museum of Modern Art, now in their permanent collection.
- The NCBI Blast server. But Is BLAST a thing of the past? (answer: no)
- The MMSeqs2 paper
- The FoldSeek paper and a link to the FoldSeek server if you want to try it out
Jan 30, 2025 - Sequence Alignment II
- We'll be finishing up slides from last time.
- Fact and Fiction in Sequence Alignments
- Dynamic programming primer
- An example of dynamic programming using Excel, created by Michael Hoffman (a former U Texas undergraduate, now U Toronto professor, who took a prior incarnation of this class)
- A few examples of proteins with internally repetitive sequences: 1, 2, 3
Jan 28, 2025 - Sequence Alignment I
- Reminder relevant to our discussion of ChatGPT last class: CNET & other news sources used it to write articles; this Gizmodo story found that "the AI-program fabricates information and bungles facts like nobody’s business" and CNET was "forced to issue multiple, major corrections". So, if you do opt to try ChatGPT to help with Python, be sure to check (and then double-check) everything. And in related news, the Chinese company DeepSeek released an open source ChatGPT competitor. According to wikipedia, "On January 27, 2025, the DeepSeek AI chatbot became the most downloaded free app in the U.S. on Apple’s App Store, surpassing ChatGPT and causing Nvidia's share price to drop by 18%."
- Today's slides
Problem Set I, due 10PM Feb. 5, 2025:
- Problem Set 1
- H. influenzae genome. Haemophilus influenza was the first free living organism to have its genome sequenced. NOTE: there are some additional characters in this file from ambiguous sequence calls. For simplicity's sake, when calculating your nucleotide and dinucleotide frequencies, you can just ignore anything other than A, C, T, and G. Also, if you prefer a .fasta format file (e.g. for BioPython), just add a first line to the text file starting with a ">" character, e.g. "> Hinfluenzae genome file".
- T. aquaticus genome. Thermus aquaticus helped spawn the genomic revolution as the source of heat-stable Taq polymerase for PCR.
- 3 mystery genes (for Problem 5): MysteryGene1, MysteryGene2, MysteryGene3
- *** HEADS UP FOR THE PROBLEM SET *** If you try to use the Python string.count function to count dinucleotides, Python counts non-overlapping instances, not overlapping instances. So, AAAA is counted as 2, not 3, dinucleotides. You want overlapping dinucleotides instead, so will have to try something else, such as the python string[counter:counter+2] command, as explained in the Rosalind homework assignment on strings.
Extra reading, if you're curious:
- BLOSUM primer
- The original BLOSUM paper (hot off the presses from 1992!)
- BLOSUM miscalculations improve performance
Jan 23, 2025 - Intro to Python II
- Reminder that today will be part 2 of the "Python boot camp" for those of you with little to no previous Python coding experience. We'll be finishing the slides from last time, plus Rosalind help & programming Q/A.
- *** Rosalind assignments are due by 10 PM January 24. ***
- We'll talk a bit about ChatGPT today for co-programming. My strong recommendation for Python newbies is to not use it for writing programs when you're just getting started, but rather use it as a helper and teacher in interpreting code and suggesting commands. That way, you give yourself a chance to properly internalize the basic Python concepts, formatting, etc. Your use will increase naturally as you start to write more complex code, by which time you'll have a much better ability to gauge the correctness of its suggestions.
- Another recommendation to the Python newbies is to download Eric Matthes's great, free Python command cheat sheets that he provides to accompany his Python Crash Course book.
Jan 21, 2025 - UT Closed for Icy Weather
- If you haven't already seen the UT emergency news web page, UT Austin will be closed Tue, Jan 21, 2025, due to forecast frozen precipitation and dangerous travel conditions. All classes are cancelled for the day. The weather forecast looks fine (so far) for the rest of the week, so at the moment, we expect to resume on Thursday with the other half of the Python boot camp. Since we haven't talked about some of the material yet, I extended the Rosalind deadline to this Friday, Jan 24.
Jan 20, 2025 - Martin Luther King, Jr. Day; no classes (or office hours) held
Jan 16, 2025 - Intro to Python
- Remember that today and the next lecture are dedicated to the Python Boot Camp to start getting those of you with minimal coding skills up to speed on the basics. Experienced programmers can skip class!
- And a reminder about the mechanics of this class: Lectures will generally be about algorithms and concepts, while the coding help hours (or my office hours) are for you to get individual coding help and feedback. Please plan to go to coding help hours if you need that support!
- Science news of the day: The UK is launching a massive project to profile the plasma proteomes (>5K proteins) from each of >500M UK participants in the UK Biobank, accompanied by X-rays and longitudinal health data.
- A request for when you turn in code for Rosalind: please just cut the text code out of Jupyter and paste/upload that into Rosalind, rather than uploading the .ipynb files (which are not intended to be human readable)
- Today's slides.
- E. coli genome (formatted as a text file with no extra lines)
- E. coli genome (formatted as a fasta file, which only differs here in having a header)
- Don't forget that the Rosalind assignments are due by 10 PM January 22. Please do start if you haven't already, or you won't have time to get help if you have any issues installing Python.
- We'll use Python version 3 (any version after 3.0 should be fine; just get the latest version in Anaconda), but Rosalind and some older materials are only available in Python 2.7, so we'll generally try to be version agnostic for compatibility. For beginners, the differences are quite minimal and are summarized in a table here. There's also a great cheat sheet here for writing code compatible with both versions.
Jan 14, 2025 - Introduction
- Today's slides
- We'll be conducting homework using the online environment Rosalind. Go ahead and register on the site, and enroll specifically for BCH394P/364C (Spring 2025) Systems Biology/Bioinformatics using this link. Homework #1 (worth 10% of your final course grade) has already been assigned on Rosalind and is due by 10:00PM January 22.
- We'll be using the free Anaconda distribution of Python and Jupyter (download here). Note that there are many other options out there, such as Google colab. You're welcome to use those, but we'll restrict our teaching and TA help sessions to Jupyter/Anaconda for simplicity.
Here are some online Python resources that you might find useful:
- First and foremost, and very, very useful if you're a complete Python newbie: Eric Matthes's Python Crash Course book. He made some GREAT, free Python command cheat sheets to support the book.
- Practical Python, worth checking out!
- If you have any basic experience at all in other programming languages, Google offered an extremely good, 2-day intro course to Python (albeit version 2) that is now available on Youtube.
- Khan Academy has archived their older intro videos on Python here (again, version 2)
Syllabus & course outline
An introduction to systems biology and bioinformatics, emphasizing quantitative analysis of high-throughput biological data, and covering typical data, data analysis, and computer algorithms. Topics will include introductory probability and statistics, basics of Python programming, protein and nucleic acid sequence analysis, genome sequencing and assembly, proteomics, analysis of large-scale gene expression data, data clustering & classification, biological pattern recognition, gene and protein networks, AI/machine learning, and protein 3D structure prediction/design.
Open to graduate students and upper division undergrads (with permission) in natural sciences and engineering.
Prerequisites: Basic familiarity with molecular biology, statistics & computing, but realistically, it is expected that students will have extremely varied backgrounds. Undergraduates have additional prerequisites, as listed in the catalog.
Note that this is not a course on practical sequence analysis or using web-based tools. Although we will use these, the focus of the course will be on learning the underlying algorithms, exploratory data analyses, and their applications, esp. in high-throughput biology. By the end of the course, students will know the fundamentals of important algorithms in bioinformatics and systems biology, will be able to design and implement computational studies in biology, and will have performed an element of original computational biology research.
Most of the lectures will be from research articles and slides posted online, with some material from the...
Optional text (for sequence analysis): Biological sequence analysis, by R. Durbin, S. Eddy, A. Krogh, G. Mitchison (Cambridge University Press),
For biologists rusty on their stats, The Cartoon Guide to Statistics (Gonick/Smith) is very good. A reasonable online resource for beginners is Statistics Done Wrong. A truly excellent stats book with a free download is An Introduction to Statistical Learning, by James, Witten, Hastie, Tibshirani, and Taylor, and is accompanied by many supporting Python examples and applications.
Two other online probability & stats references: #1, #2 (which has some lovely visualizations)
No exams will be given. Grades will be based on online homework (counting 30% of the grade), 3 problem sets (given every 2-3 weeks and counting 15% each towards the final grade) and an independent course project (25% of the final grade), which can be collaborative (1-3 students/project). The course project will consist of a research project on a bioinformatics topic chosen by the student (with approval by the instructor) containing an element of independent computational biology research (e.g. calculation, programming, database analysis, etc.). This will be turned in as a link to a web page. The final project is due by 10 PM, April 16, 2025. The last 3 classes will be spent presenting your projects to each other. (The presentation will account for 5/25 points of the project grade.)
If at some point, we have to go into coronavirus lockdown, that portion of the class will be web-based. We will hold lectures by Zoom during the normally scheduled class time. Log in to the UT Canvas class page for the link, or, if you are auditing, email the TA and we will send the link by return email. Slides will be posted before class so you can follow along with the material. We'll record the lectures & post the recordings afterward on Canvas so any of you who might be in other time zones or otherwise be unable to make class will have the opportunity to watch them. Note that the recordings will only be available on Canvas and are reserved only for students in this class for educational purposes and are protected under FERPA. The recordings should not be shared outside the class in any form. Violation of this restriction could lead to Student Misconduct proceedings.
Online homework will be assigned and evaluated using the free bioinformatics web resource Rosalind.
All projects and homework will be turned in electronically and time-stamped. No makeup work will be given. Instead, all students have 5 days of free “late time” (for the entire semester, NOT per project, and counting weekends/holidays). For projects turned in late, days will be deducted from the 5-day total (or what remains of it) by the number of days late (in 1-day increments, rounding up, i.e. 10 minutes late = 1 day deducted). Once the full 5 days have been used up, assignments will be penalized 10 percent per day late (rounding up), i.e., a 50-point assignment turned in 1.5 days late would be penalized 20%, or 10 points.
Homework, problem sets, and the project total to a possible 100 points. There will be no curving of grades, nor will grades be rounded up. We’ll use the plus/minus grading system, so: A= 92 and above, A-=90 to 91.99, etc. Just for clarity's sake, here are the cutoffs for the grades: 92% = A, 90% = A- < 92%, 88% = B+ < 90%, 82% = B < 88%, 80% = B- < 82%, 78% = C+ < 80%, 72% = C < 78%, 70% = C- < 72%, 68% = D+ < 70%, 62% = D < 68%, 60% = D- < 62%, F < 60%.
Students are welcome to discuss ideas and problems with each other, but all programs, Rosalind homework, problem sets, and written solutions should be performed independently (except for the final collaborative project). Students are expected to follow the UT honor code. Cheating, plagiarism, copying, & reuse of prior homework, projects, or programs from CourseHero, Github, or any other sources are all strictly forbidden and constitute breaches of academic integrity and cause for dismissal with a failing grade, possibly expulsion (UT's academic integrity policy). In particular, no materials used in this class, including, but not limited to, lecture hand-outs, videos, assessments (papers, projects, homework assignments), in-class materials, review sheets, and additional problem sets, may be shared online or with anyone outside of the class unless you have the instructor’s explicit, written permission. Any materials found online (e.g. in CourseHero) that are associated with you, or any suspected unauthorized sharing of materials, will be reported to Student Conduct and Academic Integrity in the Office of the Dean of Students. These reports can result in sanctions, including failure in the course.
The use of artificial intelligence tools (such as ChatGPT or Github co-pilot) in this class shall be permitted on a limited basis for programming assignments. You are also welcome to seek my prior-approval to use AI writing tools on any assignment. In either instance, AI writing tools should be used with caution and proper citation, as the use of AI should be properly attributed. Using AI writing tools without my permission or authorization, or failing to properly cite AI even where permitted, shall constitute a violation of UT Austin’s Institutional Rules on academic integrity.
Students with disabilities may request appropriate academic accommodations from Disability and Access.
The final project website is due by 10 PM April 16, 2025
- How to make a website for the final project
- Google Site: https://sites.google.com/new
- You might also consider streamlit, which lets you generate websites on the fly direct from Python