BCH394P BCH364C 2024: Difference between revisions

From Marcotte Lab
Jump to navigationJump to search
 
(9 intermediate revisions by the same user not shown)
Line 10: Line 10:


== Lectures & Handouts ==
== Lectures & Handouts ==
<!--
'''Apr 18 - 25, 2024 - Final Project Presentations'''
'''Apr 18 - 25, 2024 - Final Project Presentations'''
* Welcome to the end of the course!  You made it!  The last 3 days will be presentations of your class projects.
* Welcome to the end of the course!  You made it!  The last 3 days will be presentations of your class projects.
* We'll spend 5 minutes on the [https://utdirect.utexas.edu/ctl/ecis/ Course - Instructor Survey] Thursday morning.
* We'll spend 5 minutes on the [https://utdirect.utexas.edu/ctl/ecis/ Course - Instructor Survey] Thursday morning.
Here's a sampling of some of the completed course projects (posted with permission, with more to come):
Here's a sampling of some of the completed course projects (posted with permission):
* [https://sites.google.com/utexas.edu/hanlin-ren-bioinformatics-proj/home Relative Depth of Aromatic Residues in Membrane Bilayer, by Hanlin Ren]
* [https://sites.google.com/utexas.edu/deg-analysis-using-pydeseq2/home RNAseq Analysis using PyDESeq2 to identify differentially expressed genes in the progression of Triple-Negative Breast Cancer, by Oihik Mitra,  Atri Bhattacharya,  Aritra Roy]
* [https://sites.google.com/utexas.edu/bch394p-influenza/home Influenza Sequence Analysis, by Travis Beck & Evelyn Rocha]
* [https://sites.google.com/utexas.edu/iggfcrn/main-content Modeling and improving IgG3:FcRn Binding for Potential Therapeutic Use, by Ranya Al-Khaledy & Kristin Connelly]
* [https://sites.google.com/view/subcellularloc/projects Signal peptides and subcellular localisation, by Sophia Zhou]
* [https://sites.google.com/view/heiser-dockery-bechtel/introductionaims CYSTIC FIBROSIS, by Grace Bechtel, Brittany Heiser, Katelyn Dockery]
* [https://sites.google.com/utexas.edu/bch394pbioinformaticsproject/introduction?authuser=0 Hidden Markov Models for Predicting Protein Secondary Structures, by Anant Beechar, Grace Hu, Rayna Taniguchi]
* [https://sites.google.com/utexas.edu/g-quadruplexes/methods G-quadruplexes, by Shelby Rheinschmidt, Zoya Ansari, Recca Holzel]
* [https://sites.google.com/utexas.edu/voigt-final-project/home?authuser=0 A Structural Investigation into Scospondin & the Reissner Fiber, by Brittney Voigt]
* [https://sites.google.com/view/bch364c-irf3project Identifying Potential Consequences of Polymorphisms Using Structural Similarity Analysis, by Mohammad Aga and Kevin Tran]
* [https://sites.google.com/utexas.edu/csra-orthogonality-project/results Development of a Model to predict CsrA-RNA binding, by Ryan Buchser & Vinya Bhuvan]
* [https://sites.google.com/utexas.edu/bioin-cancer-detection-project?usp=sharing Skin Cancer Machine Learning, by Ali Mohsin, Laurie Dong, Zahra Karim]
* [https://sites.google.com/view/bch-364c-final-project/home Extending Cascade Models of Synaptic Plasticity, Argha Bandyopadhyay]
* [https://sites.google.com/utexas.edu/bioinformatics-project Exploring Structural Heterogeneity in Intrinsically Disordered Proteins, by Parivash Feyzishendi]
* [https://sites.google.com/view/ama1-polymorphism/home?authuser=0 Genetic diversity of Plasmodium falciparum apical membrane antigen-1, by Christopher Smith, Jeffrey Marchioni, Jin Eyun Kim]
* [https://sites.google.com/utexas.edu/antibody-classification/results Utilizing amino acid sequences of antibodies to categorize them in to different classes and their affinity to different Fc receptors, by Gabriela Bastidas, Mica Cabrera, Truong Nguyen]
* [https://sites.google.com/view/bioinformaticsproject/introduction-and-goals?authuser=0 Identifying putative stabilizing disulfide bond mutations for viral fusion protein vaccine design with machine learning, by Doug Townsend & W. Chase Sanders]
* [https://sites.google.com/utexas.edu/rps10/home?authuser=0 Investigating the impacts of RPS10 knockdown on Mitochondrial Gene Expression, by Da Huo, Xingxing Zhao, Shuya Lu]
* [https://sites.google.com/view/finalproject-com/title?authuser=0 Investigation of Unique Intron Associated RT, by Jose Alvarado]
* [https://sites.google.com/utexas.edu/biofxfinalprojectdanipranesh?usp=sharing Predicting Copy Number Variation in Microbial Genome Resequencing Data, by Dani Lawson, Pranesh Rao]
* [https://sites.google.com/utexas.edu/oishika-das-bioinformatics-pro/home Breast Cancer Classification Using Tumor Characteristics: An Analysis through Pandas and Numpy, by Oishika Das]
* [https://sites.google.com/view/a-synucleindms?usp=sharing Predictive Model of Deep Mutation Scanning Fitness Landscape, by Nathan Strominger, Luiz Vieira]
* [https://sites.google.com/view/kcgslc30a10 Regulators of Manganese Efflux Transporter SLC30A10, by Kerem Gurol]
* [https://sites.google.com/utexas.edu/bch394p-2024/home?authuser=0 Computational Investigation of Point Mutations in the Tumor Suppressor Protein p53, by Wes Wolfe, Mikayla Horvath]
* [https://sites.google.com/view/bioinformaticsprojectjustin/references You discovered an antibody, now what?, by Justin Lerma]
 
* [https://sites.google.com/view/bch394p-project/home Predicting ISGylation Sites with Machine Learning Models, Xu Zhao]
-->


<!--
'''April 16, 2024 - Synthetic Biology, highly compressed'''
'''April 16, 2024 - Synthetic Biology, highly compressed'''
* '''Reminder: All projects are due by 10PM, April 12'''.  Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR.   
* '''Reminder: All projects are due by 10PM, April 17'''.  Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR.   
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BCH394P-364C_SyntheticBio_Spring2024.pdf Today's slides]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BCH394P-364C_SyntheticBio_Spring2024.pdf Today's slides]
A collection of further reading, if you're so inclined:
A collection of further reading, if you're so inclined:
* [http://www.marcottelab.org/users/BCH394P_364C_2024/GenomeTransplantation.pdf Genome Transplantation]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/NewCellFromChemicalGenome.pdf A new cell from a chemically synthesized genome]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/MinimalMycoplasma-2016.pdf Minimal Mycoplasma]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/MinimalMycoplasma-2016.pdf Minimal Mycoplasma]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/GenomeTransplantation.pdf Genome Transplantation]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/SyntheticEcoliGenome.pdf Synthetic E. coli genome]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/JCVI-1.0.pdf JCVI-1.0]
* [http://syntheticyeast.org/ Synthetic Yeast: Sc2.0 ]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/OneStepAssemblyInYeast.pdf One step genome assembly in yeast]
* [http://science.sciencemag.org/content/355/6329/1040.long Sc 2.0 computational genome design]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/StrainsFromYeastGenomicClones.pdf New cells from yeast genomic clones]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/NewCellFromChemicalGenome.pdf A new cell from a chemically synthesized genome], [http://www.marcottelab.org/users/BCH394P_364C_2024/NewCellFromChemicalGenome.SOM.pdf SOM]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/YeastSynthCsome.pdf 1/2 a synthetic yeast chromosome] and [http://syntheticyeast.org/ Build-A-Genome]
*  [http://www.marcottelab.org/users/BCH394P_364C_2024/Science-2014-Annaluru-55-8.pdf Entire synthetic yeast chromosome]  
* [http://science.sciencemag.org/content/355/6329/1040.long Sc 2.0, as of 2017], with the [http://science.sciencemag.org/content/355/6329/1038 computational genome design]
* [http://en.wikipedia.org/wiki/Gillespie_algorithm The Gillespie algorithm]
* [https://www.igem.org/Main_Page iGEM], and an example part ([http://parts.igem.org/Featured_Parts:Light_Sensor the light sensor])
* [http://www.popsci.com/diy/article/2013-08/grow-photo Take your own coliroids]
* [http://www.popsci.com/diy/article/2013-08/grow-photo Take your own coliroids]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/repressilator.pdf The infamous repressilator]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/repressilator.pdf The infamous repressilator]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BacterialPhotography.pdf Bacterial photography], and [http://www.marcottelab.org/users/BIO337_2014/UTiGEM2012.pdf UT's 2012 iGEM entry]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BacterialPhotography.pdf Bacterial photography]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/EdgeDetector.pdf Edge detector]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/EdgeDetector.pdf Edge detector]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/nbt.2510.pdf A nice example of digital logic]
[https://colossal.com/ Food for thought]
[https://colossal.com/ Food for thought]
-->


<!--
 
'''April 11, 2024 - Orthologs and Phenologs'''
'''April 12, 2024 - A couple of relevant papers'''
* A nice paper just came out relevant to our last lecture about selecting good research problems.  [http://www.marcottelab.org/users/BCH394P_364C_2024/ChoosingAProblemInScienceAndEngineering.pdf Here's the pdf].
* Second, there is a nice tutorial on using AlphaFold and ChimeraX from EMBL/DFG (Kosinski group) available [https://docs.google.com/document/d/1_g1_M-I40CqOQc5obwAt08YntC5D2Z_WNz6mYuUQtyc/edit#heading=h.m7ei2f72v2ig here].
 
 
'''April 11, 2024 - Orthologs, Paralogs, and Phenologs'''
* '''Remember: The final project web page is due by 10PM April 17, 2024, turned in as a URL emailed to the TA+Professor.  Please indicate in the email if you are willing to let us post the project to the course web site.  Also, note that ''late days can't be used for the final project'' '''  
* '''Remember: The final project web page is due by 10PM April 17, 2024, turned in as a URL emailed to the TA+Professor.  Please indicate in the email if you are willing to let us post the project to the course web site.  Also, note that ''late days can't be used for the final project'' '''  
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BCH394P-364C_Phenologs_Spring2024.pdf Today's slides]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BCH394P-364C_Phenologs_Spring2024.pdf Today's slides]
Line 62: Line 56:
* Search for phenologs [http://www.phenologs.org/ here].  You can get started by rediscovering the plant model of Waardenburg syndrome.  Search among the known diseases for "Waardenburg", or enter the human genes linked to Waardenburg (Entrez gene IDs 4286, 5077, 6591, 7299) to get a feel for how this works.
* Search for phenologs [http://www.phenologs.org/ here].  You can get started by rediscovering the plant model of Waardenburg syndrome.  Search among the known diseases for "Waardenburg", or enter the human genes linked to Waardenburg (Entrez gene IDs 4286, 5077, 6591, 7299) to get a feel for how this works.
Tools for finding orthologs:<br>
Tools for finding orthologs:<br>
* One good tool for discovering orthologs is [https://inparanoidb.sbc.su.se/ InParanoid].  Note: InParanoid annotation lags a bit, so you'll need to find the [http://www.ensembl.org/index.html Ensembl] protein id, or try a text search for the common name. Or, just link there from [http://www.uniprot.org/ Uniprot]. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include [http://omabrowser.org/oma/home/ OMA] (introduced in [http://www.marcottelab.org/users/BCH394P_364C_2024/OMA.pdf this paper]), [http://phylomedb.org/ PhylomeDB], and [http://eggnogdb.embl.de/#/app/home EggNOG].  The various algorithms basically have different trade-offs with regard to precision vs recall, and ease of use.  For example, we use EggNOG in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in.
* One good tool for discovering orthologs is [https://inparanoidb.sbc.su.se/ InParanoid].  Note: InParanoid annotation lags a bit, so you'll need to find the [http://www.ensembl.org/index.html Ensembl] protein id, or try a text search for the common name. Or, just link there from [http://www.uniprot.org/ Uniprot]. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include [http://omabrowser.org/oma/home/ OMA] (introduced in [http://www.marcottelab.org/users/BCH394P_364C_2024/OMA.pdf this paper]), [http://phylomedb.org/ PhylomeDB], and [http://eggnogdb.embl.de/#/app/home EggNOG].  The various algorithms basically have different trade-offs of precision, recall, and ease of use.  For example, we use EggNOG in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in.
* All (well, at least some) of [http://www.marcottelab.org/users/BCH394P_364C_2024/Sonnhammer2002TiG.pdf your ortholog definition questions answered!]
* All (well, at least some) of [http://www.marcottelab.org/users/BCH394P_364C_2024/Sonnhammer2002TiG.pdf your ortholog definition questions answered!]
-->


<!--
'''Apr 11, 2024 - Deep learning'''
* Guest speaker: [https://scholar.google.com/citations?hl=en&user=AOYsDhsAAAAJ&view_op=list_works&sortby=pubdate Dr. Claire McWhite], who is a Lewis-Sigler Fellow at Princeton where she develops protein language models using deep learning. She previously completed her B.S. at Rice University, interned at the National Cancer Institute, earned her Ph.D. at UT Austin working extensively in computational biology and proteomics, and appeared as a contestant in [http://bahfest.com/houston2017/ BahFest].
* [http://www.marcottelab.org/users/BCH394P_364C_2024/ClaireMcWhite-BCH394p-364c_2024.pdf Today's slides]
* [https://www.youtube.com/watch?v=CfAL_cL3SGQ Why neural networks aren't neural networks]
-->


<!--
'''Apr 9, 2024 - Computational Protein Design'''
'''Apr 9, 2024 - Networks'''
* [http://www.marcottelab.org/users/BCH394P_364C_2024/ComputationalProteinDesign_Spring2024.pdf Today's slides]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/BCH394P-364C_Networks_Spring2024.pdf Today's slides]
* Lots of very good supporting papers today, highly recommended to at least scan and get the high points: [http://www.marcottelab.org/users/BCH394P_364C_2024/ESMFold_2023.pdf ESMFold] [http://www.marcottelab.org/users/BCH394P_364C_2024/RoseTTAFoldAllAtom.pdf RosettaFold All-Atom] [http://www.marcottelab.org/users/BCH394P_364C_2024/RFDiffusion_2023.pdf RFDiffusion] [http://www.marcottelab.org/users/BCH394P_364C_2024/NBTPrimer_GenerativeProteinDesign.pdf NBT primer on generative protein design] [http://www.marcottelab.org/users/BCH394P_364C_2024/NBTPrimer_ProteinLanguageModels.pdf NBT primer on protein language models]
* Metabolic networks: [https://web.expasy.org/pathways/ The wall chart] (it's interactive. For example, can you find enolase?), the [https://metabolicatlas.org/ human metabolic reaction network], a review of [http://www.marcottelab.org/users/BCH394P_364C_2024/ChIP-profiling-review.pdf mapping transcriptional networks by Chip-SEQ] (with the current record holder in this regard probably held by [https://www.encodeproject.org/ ENCODE]), and a review of [http://www.marcottelab.org/users/BCH394P_364C_2024/PPIsAndDiseaseReview.pdf protein interaction mapping in humans] and how it is informing disease genetics.
* Try it yourself! Here's the [https://colab.research.google.com/github/sokrypton/ColabDesign/blob/main/rf/examples/diffusion.ipynb RFDiffusion + ProteinMPNN colab notebook for protein backbone + sequence design], [https://huggingface.co/spaces/simonduerr/ProteinMPNN a site for running ProteinMPNN in isolation for protein sequence redesign], and [https://colab.research.google.com/github/ullahsamee/ligandMPNN_Colab/blob/main/LigandMPNN_Colab.ipynb the LigandMPNN colab notebook for small-molecule award protein sequence redesign].
* Useful gene network resources include:
 
** [http://www.reactome.org/ Reactome]), which we've seen before, links human genes according to reactions and pathways, and also calculated functional linkages from various high-throughput data.
 
** [https://www.inetbio.org/humannet/ HumanNet] (older versions for other organisms at [https://netbiolab.org/w/Software netbiolab.org] and [http://www.functionalnet.org FunctionalNet]), which provides interactive searches of a human functional gene network. The earlier versions helped my own group find genes for a wide variety of biological processes.
** [http://string-db.org/ STRING] is available for many organisms, including large numbers of prokaryotes. Try searching on the <i>E. coli</i> enolase (Eno) as an example.
** [http://www.genemania.org/ GeneMania], which aggregates many individual gene networks.
** The best interactive tool for network visualization is [http://www.cytoscape.org/ Cytoscape]. You can download and install it locally on your computer, then visualize and annotated any gene network, such as are output by the network tools linked above.  There is also a web-based network viewer that can be incorporated into your own pages (e.g., as used in [http://www.inetbio.org/yeastnet/ YeastNet]).  Here's an example file to visualize, the [http://humap2.proteincomplexes.org/static/downloads/humap2/humap2_protein_complex_map_20200821.cys human protein complex map] from [http://humap2.proteincomplexes.org/ Hu.MAP2].
** Clustering algorithms can be applied to networks. For example, we frequently use the [http://www.marcottelab.org/users/BCH394P_364C_2024/WalktrapAlgorithm.pdf Walktrap algorithm] developed by Pascal Pons and Matthieu Latapy, which is available in the Python iGraph library. Here's [https://towardsdatascience.com/detecting-communities-in-a-language-co-occurrence-network-f6d9dfc70bab a nice blog demonstration] using it.
Reading:<br>
* [http://www.marcottelab.org/users/BCH394P_364C_2024/YeastSGA-2016.pdf The Yeast SGA map]
* [http://www.marcottelab.org/paper-pdfs/Cell_PlantComplexes_2020.pdf The pan-plant PPI map]
* [http://www.marcottelab.org/paper-pdfs/ng-fraser-review.pdf Functional networks]
* [http://www.marcottelab.org/paper-pdfs/JProteomics_GBAReview_2010.pdf Review of predicting gene function and phenotype from protein networks]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/NBTPrimer-NetworkVisualization.pdf Primer on visualizing networks]
-->
'''Apr 4, 2024 - Large Language Models in Biology'''
'''Apr 4, 2024 - Large Language Models in Biology'''
* [http://www.marcottelab.org/users/BCH394P_364C_2024/AaronFeller_2024-04-04_TeachingLanguageModelstoSpeakBiology.pdf Today's slides]
* [http://www.marcottelab.org/users/BCH394P_364C_2024/AaronFeller_2024-04-04_TeachingLanguageModelstoSpeakBiology.pdf Today's slides]

Latest revision as of 22:17, 25 April 2024

BCH394P/BCH364C Systems Biology & Bioinformatics

Course unique #: 54430/54305
Lectures: Tues/Thurs 11 – 12:30 PM WEL 2.110
Instructor: Edward Marcotte, marcotte @ utexas.edu

  • Office hours: Mon 4 – 5 PM on the class Zoom channel (available on Canvas)

TA: Vicki Deng, dengv @ utexas.edu

  • TA Office hours: Tues 1 - 2 PM / Fri 12 - 1 PM in MBB 3.204 or by appointment on Zoom

Class Canvas site: https://utexas.instructure.com/courses/1379402

Lectures & Handouts

Apr 18 - 25, 2024 - Final Project Presentations

  • Welcome to the end of the course! You made it! The last 3 days will be presentations of your class projects.
  • We'll spend 5 minutes on the Course - Instructor Survey Thursday morning.

Here's a sampling of some of the completed course projects (posted with permission):


April 16, 2024 - Synthetic Biology, highly compressed

  • Reminder: All projects are due by 10PM, April 17. Turn them in as a URL to the web site you created, sent by email to the TA AND PROFESSOR.
  • Today's slides

A collection of further reading, if you're so inclined:

Food for thought


April 12, 2024 - A couple of relevant papers

  • A nice paper just came out relevant to our last lecture about selecting good research problems. Here's the pdf.
  • Second, there is a nice tutorial on using AlphaFold and ChimeraX from EMBL/DFG (Kosinski group) available here.


April 11, 2024 - Orthologs, Paralogs, and Phenologs

  • Remember: The final project web page is due by 10PM April 17, 2024, turned in as a URL emailed to the TA+Professor. Please indicate in the email if you are willing to let us post the project to the course web site. Also, note that late days can't be used for the final project
  • Today's slides
  • Phenologs and the drug discovery story we'll discuss in class. This is a fun example of the power of opportunistic data mining aka "research parasitism" in biomedical research.
  • Search for phenologs here. You can get started by rediscovering the plant model of Waardenburg syndrome. Search among the known diseases for "Waardenburg", or enter the human genes linked to Waardenburg (Entrez gene IDs 4286, 5077, 6591, 7299) to get a feel for how this works.

Tools for finding orthologs:

  • One good tool for discovering orthologs is InParanoid. Note: InParanoid annotation lags a bit, so you'll need to find the Ensembl protein id, or try a text search for the common name. Or, just link there from Uniprot. InParanoid tends towards higher recall, lower precision for finding orthologs. Approaches with higher precision include OMA (introduced in this paper), PhylomeDB, and EggNOG. The various algorithms basically have different trade-offs of precision, recall, and ease of use. For example, we use EggNOG in the lab for annotating genes in new genomes/transcriptomes because the EggNOG HMM ortholog models are easily downloadable/re-run on any set of genes you happen to be interested in.
  • All (well, at least some) of your ortholog definition questions answered!


Apr 9, 2024 - Computational Protein Design


Apr 4, 2024 - Large Language Models in Biology

  • Today's slides
  • Aaron Feller. Aaron is a computational biologist and PhD student in our program specializing in large language models. (His LinkedIn Bio is literally "Ask me about biological language models.") He will be providing a conceptual basis for how LLMs work and are applied to biological datasets.


Apr 2, 2024 - 3D Protein Structure Modeling with AlphaFold & ChimeraX

  • Today's slides
  • Guest speaker: Daryl Barth. Daryl is a computational synthetic biologist and PhD student in our program doing active research in computational protein structure prediction and design, with a focus on developing new-to-nature enzyme catalysts. She will talk about the use of techniques like AlphaFold and RosettaFold for protein 3D structure modeling and prediction.
  • 3D macromolecular structural modeling software: UCSF ChimeraX, the Rosetta software suite, and an overview of what it can do for you, and last but not least: AlphaFold predicted structures and the AlphaFold colab where you can run your own structure predictions.
  • & a few other useful 3D structure tools: The Protein Data Bank, MODELLER, and Pymol


Mar 28, 2024 - Principal Component Analysis (& the curious case of European genotypes)

A smattering of links on PCA:


Mar 26, 2024 - Classifiers


Mar 21, 2024 - Clustering II

  • We'll be continuing the slides from last time

Reading:


Mar 19, 2024 - Functional Genomics & Data Mining - Clustering I

Reading:


Mar 18, 2024

  • For those of you struggling with the Rosalind New Motif Discovery problem because of Meme taking too long, you can paste the input sequences + meme output into a single file and submit that through Canvas, and we'll give you credit for it.


Mar 12,14, 2024 - SPRING BREAK

  • Don't forget to turn in the proposal for your course project by March 18.


Mar 7, 2024 - Genome Assembly/Mapping II

Supporting reading:


Mar 5, 2024 - Genome Assembly - I

  • Homework #3 (worth 10% of your final course grade) has been assigned on Rosalind and is due by 10:00PM March 18. In past years, we've run into problems with Rosalind timing out before Meme completes although it usually runs eventually, so be warned you may have to try it a couple of times. Meme also runs faster using the "zero to one" or "one" occurrence per sequence option, rather than the "any number of repeats" option.
  • Due March 18 by email to the TA+Instructor - One to two (full) paragraphs describing your plans for a final project, along with the names of your collaborators. Please limit to no more than 3 per group, please. It's also fine to do this independently, if you prefer. (Do you have a particular skill/interest/exciting dataset you need help analyzing? We'll spend a few minutes at the start of class asking around for partners.) This assignment (planning out your project) will account for 5 points out of your 25 total points for your course project. Here are a few examples of final projects from previous years: 1 2 3 4 5 6 7 8 9. Remember that the project itself will ultimately be due one month later on April 17 (& late days can't be used for the final project.)
  • Today's slides
  • Regarding the difficulties finding short genes: New evidence for very short human ORFs coding for real microproteins & peptides
  • Science news of the day: A compilation of advances in the last 2 years on deep learning protein structure prediction. The latest issue of Nature Biotechnology focuses extensively on new AI-guided protein engineering methods. We'll go into these methods extensively in the last portion of the course.
  • Relevant to the last lecture, some definitions of sensitivity/specificity & precision/recall. Note that the gene finding community settled early on to a different definition of specificity that corresponds to the precision or PPV in other fields. Other fields define specificity as the true negative rate.
  • DeBruijn Primer and Supplement


Feb 29, 2024 - Intro to Proteomics

  • Guest speaker: Vy Dang, who earned her B.S. and subsequently worked in genomics at the University of Washington, Seattle, where she was a major contributor to the sequencing of the Melanesian genome before joining us at UT. Here, she has performed >2,000 mass spectrometry proteomics experiments to map brain protein-protein interactions conserved across vertebrates.


Feb 27, 2024 - NGS analysis best practices


Feb 26, 2024 - Apologies, no office hours today. Feel free to reach out by email or attend the TA office hours this week.


Feb 22, 2024 - Hot off the presses update!

  • I was poking around in recent literature after class and ran across the following bioRxiv preprint (posted 3 days ago!) bench-marking the major motif-finding algorithms. They particularly recommended DEME, Opal, and SLiMFinder. DEME and Opal seem a bit harder to access, but SLiMFinder can be run through a web server (also accessible here).


Feb 22, 2024 - Motifs


Feb 20, 2024 - Gene finding II

  • Short classes at UT will be offered starting in March in programming, bioinformatics, genome sequencing, and cryoEM
  • We're finishing up the slides from last time.
  • If you would like a few examples of proteins with their transmembrane and soluble regions annotated (according to UniProt) to help troubleshoot your homework, here are some example yeast protein sequences.

Reading:


Feb 15, 2024 - Gene finding

Problem Set 2, due before 10 PM, Feb. 26, 2024:

Reading (a couple of old classics + a review + better splice site detection):


Feb 13, 2024 - HMMs II

  • Happy day-before-Valentine's Day! We'll be finishing up slides from last time.
  • Science news of the day: 2000 years after they were buried in lava by Mt. Vesuvius, and 275 years after they were unearthed by archeologists, the first significant portion of the Herculaneum Papyri (from a neighboring town to Pompeii) have finally been read. There are about a thousand of these scrolls, possibly thousands more still to be unearthed, in the only known intact library from the ancient world. They've been unreadable until now because they're all in the form of charred, cemented remains. The breakthrough comes from X-ray imaging the scrolls with a particle accelerator, then computationally unwrapping the layers (somewhat analogous to segmenting images in cryotomography) and sophisticated image analysis + machine learning to read the characters from the subtle differences in X-ray densities due to the ink.
  • Link to a great interactive visualization of Markov chains, by Victor Powell & Lewis Lehe. It's worth checking out to build some intuition. They correctly point out that Google's PageRank algorithm is based on Markov chains. There, the ranking of pages in a web search relates to how random walks across linked web pages spend more time on some pages than on others.
  • A non-biological example of using log odds ratios & Bayesian stats to learn the authors of the Federalist Papers. In a related example, researchers just decoded >50 coded letters from a French archive and discovered they were lost correspondence from Mary, Queen of Scots, before she was executed in 1587 for treason against Elizabeth I. The researchers used an approach closely related to computing log odds ratios of 5-mer frequencies between putative decoded texts and known free text to figure out the correct ciphers. If you're curious, you can read about it in Appendix A of their paper


Feb 8, 2024 - Hidden Markov Models

Reading:


Just a reminder about the mechanics of this class: Lectures will generally be about algorithms and concepts, while the coding help hours (or my office hours) are for you to get individual coding help and feedback. Please plan to go to coding help hours if you need that support!


Feb 6, 2024 - Biological databases

Homework #2 (worth 10% of your final course grade) has been assigned on Rosalind and is due by 10 PM February 14:

  • Besides giving a bit more programming experience, these questions will also give you some more practice with the BioPython Python library (see the "programming shortcuts" at the bottom of several questions). If you have yet to install BioPython on your computer, open an Anaconda prompt window (on a PC) or launch a console window from the Anaconda Navigator & type "pip install biopython". (You can use this approach to install most Python libraries.) There's a very useful tutorial here (also downloadable as a pdf file)
  • NOTE: The problem titled "Complementing a Strand of DNA" uses a now out-of-date call for IUPAC codes in the Programming Shortcut. Just delete the "from Bio.Alphabet import IUPAC" line & delete the ", IUPAC.unambiguous_dna" portion of the Seq() functions and it will work fine. e.g. all you need is something like this: my_seq = Seq("GATCGATGGGCCTATATAGGATCGAAAATCGC")

Extra reading/classes:


Feb 1, 2024 - BLAST


Jan 30, 2024 - Sequence Alignment II


Jan 25, 2024 - Sequence Alignment I

  • Reminder relevant to our discussion of ChatGPT last class: CNET & other news sources used it to write articles; this Gizmodo story found that "the AI-program fabricates information and bungles facts like nobody’s business" and CNET was "forced to issue multiple, major corrections". So, if you do opt to try ChatGPT to help with Python, be sure to check (and then double-check) everything.
  • Today's slides

Problem Set I, due 10PM Feb. 5, 2024:

  • Problem Set 1
  • H. influenzae genome. Haemophilus influenza was the first free living organism to have its genome sequenced. NOTE: there are some additional characters in this file from ambiguous sequence calls. For simplicity's sake, when calculating your nucleotide and dinucleotide frequencies, you can just ignore anything other than A, C, T, and G. Also, if you prefer a .fasta format file (e.g. for BioPython), just add a first line to the text file starting with a ">" character, e.g. "> Hinfluenzae genome file".
  • T. aquaticus genome. Thermus aquaticus helped spawn the genomic revolution as the source of heat-stable Taq polymerase for PCR.
  • 3 mystery genes (for Problem 5): MysteryGene1, MysteryGene2, MysteryGene3
  • *** HEADS UP FOR THE PROBLEM SET *** If you try to use the Python string.count function to count dinucleotides, Python counts non-overlapping instances, not overlapping instances. So, AAAA is counted as 2, not 3, dinucleotides. You want overlapping dinucleotides instead, so will have to try something else, such as the python string[counter:counter+2] command, as explained in the Rosalind homework assignment on strings.

Extra reading, if you're curious:


Jan 23, 2024 - Intro to Python II

  • Reminder that today will be part 2 of the "Python boot camp" for those of you with little to no previous Python coding experience. We'll be finishing the slides from last time, plus Rosalind help & programming Q/A.
  • *** Rosalind assignments are due by 10 PM January 24. ***
  • We'll talk a bit about ChatGPT today for co-programming
  • Another strong recommendation (really) to the Python newbies to download Eric Matthes's GREAT, free Python command cheat sheets that he provides to accompany his Python Crash Course book.


Jan 18, 2024 - Intro to Python

  • Remember that today and the next lecture are dedicated to the Python Boot Camp to start getting those of you with minimal coding skills up to speed on the basics. Advanced programmers can skip class!
  • Today's slides.
  • E. coli genome (formatted as a text file with no extra lines; updated on Jan 23 to be the version matching the slides)
  • E. coli genome (formatted as a fasta file, which only differs here in having a header)
  • Don't forget that the Rosalind assignments are due by 10 PM January 24. Please do start if you haven't already, or you won't have time to get help if you have any issues installing Python.
  • We'll use Python version 3 (any version after 3.0 should be fine; just get the latest version in Anaconda), but Rosalind and some older materials are only available in Python 2.7, so we'll generally try to be version agnostic for compatibility. For beginners, the differences are quite minimal and are summarized in a table here. There's also a great cheat sheet here for writing code compatible with both versions.


Jan 16, 2024 - Introduction

  • Today's slides
  • We'll be conducting homework using the online environment Rosalind. Go ahead and register on the site, and enroll specifically for BCH394P/364C (Spring 2024) Systems Biology/Bioinformatics using this link. Homework #1 (worth 10% of your final course grade) has already been assigned on Rosalind and is due by 10:00PM January 24.
  • We'll be using the free Anaconda distribution of Python and Jupyter (download here). Note that there are many other options out there, such as Google colab. You're welcome to use those, but we'll restrict our teaching and TA help sessions to Jupyter/Anaconda for simplicity.

Here are some online Python resources that you might find useful:

  • First and foremost, and very, very useful if you're a complete Python newbie: Eric Matthes's Python Crash Course book. He made some GREAT, free Python command cheat sheets to support the book.
  • Practical Python, worth checking out!
  • If you have any basic experience at all in other programming languages, Google offered an extremely good, 2-day intro course to Python (albeit version 2) that is now available on Youtube.
  • Khan Academy has archived their older intro videos on Python here (again, version 2)

Syllabus & course outline

Course syllabus

An introduction to systems biology and bioinformatics, emphasizing quantitative analysis of high-throughput biological data, and covering typical data, data analysis, and computer algorithms. Topics will include introductory probability and statistics, basics of Python programming, protein and nucleic acid sequence analysis, genome sequencing and assembly, proteomics, synthetic biology, analysis of large-scale gene expression data, data clustering, biological pattern recognition, and gene and protein networks.

Open to graduate students and upper division undergrads (with permission) in natural sciences and engineering. Prerequisites: Basic familiarity with molecular biology, statistics & computing, but realistically, it is expected that students will have extremely varied backgrounds. Undergraduates have additional prerequisites, as listed in the catalog.

Note that this is not a course on practical sequence analysis or using web-based tools. Although we will use a number of these to help illustrate points, the focus of the course will be on learning the underlying algorithms, exploratory data analyses, and their applications, esp. in high-throughput biology. By the end of the course, students will know the fundamentals of important algorithms in bioinformatics and systems biology, will be able to design and implement computational studies in biology, and will have performed an element of original computational biology research.

Most of the lectures will be from research articles and slides posted online, with some material from the...
Optional text (for sequence analysis): Biological sequence analysis, by R. Durbin, S. Eddy, A. Krogh, G. Mitchison (Cambridge University Press),

For biologists rusty on their stats, The Cartoon Guide to Statistics (Gonick/Smith) is very good. A reasonable online resource for beginners is Statistics Done Wrong. A truly excellent stats book with a free download is An Introduction to Statistical Learning, by James, Witten, Hastie, Tibshirani, and Taylor, and is accompanied by many supporting Python examples and applications.

Two other online probability & stats references: #1, #2 (which has some lovely visualizations)

No exams will be given. Grades will be based on online homework (counting 30% of the grade), 3 problem sets (given every 2-3 weeks and counting 15% each towards the final grade) and an independent course project (25% of the final grade), which can be collaborative (1-3 students/project). The course project will consist of a research project on a bioinformatics topic chosen by the student (with approval by the instructor) containing an element of independent computational biology research (e.g. calculation, programming, database analysis, etc.). This will be turned in as a link to a web page. The final project is due by 10 PM, April 17, 2024. The last 3 classes will be spent presenting your projects to each other. (The presentation will account for 5/25 points of the project grade.)

If at some point, we have to go into coronavirus lockdown, that portion of the class will be web-based. We will hold lectures by Zoom during the normally scheduled class time. Log in to the UT Canvas class page for the link, or, if you are auditing, email the TA and we will send the link by return email. Slides will be posted before class so you can follow along with the material. We'll record the lectures & post the recordings afterward on Canvas so any of you who might be in other time zones or otherwise be unable to make class will have the opportunity to watch them. Note that the recordings will only be available on Canvas and are reserved only for students in this class for educational purposes and are protected under FERPA. The recordings should not be shared outside the class in any form. Violation of this restriction could lead to Student Misconduct proceedings.

Online homework will be assigned and evaluated using the free bioinformatics web resource Rosalind.

All projects and homework will be turned in electronically and time-stamped. No makeup work will be given. Instead, all students have 5 days of free “late time” (for the entire semester, NOT per project, and counting weekends/holidays). For projects turned in late, days will be deducted from the 5-day total (or what remains of it) by the number of days late (in 1-day increments, rounding up, i.e. 10 minutes late = 1 day deducted). Once the full 5 days have been used up, assignments will be penalized 10 percent per day late (rounding up), i.e., a 50-point assignment turned in 1.5 days late would be penalized 20%, or 10 points.

Homework, problem sets, and the project total to a possible 100 points. There will be no curving of grades, nor will grades be rounded up. We’ll use the plus/minus grading system, so: A= 92 and above, A-=90 to 91.99, etc. Just for clarity's sake, here are the cutoffs for the grades: 92% = A, 90% = A- < 92%, 88% = B+ < 90%, 82% = B < 88%, 80% = B- < 82%, 78% = C+ < 80%, 72% = C < 78%, 70% = C- < 72%, 68% = D+ < 70%, 62% = D < 68%, 60% = D- < 62%, F < 60%.

Students are welcome to discuss ideas and problems with each other, but all programs, Rosalind homework, problem sets, and written solutions should be performed independently (except for the final collaborative project). Students are expected to follow the UT honor code. Cheating, plagiarism, copying, & reuse of prior homework, projects, or programs from CourseHero, Github, or any other sources are all strictly forbidden and constitute breaches of academic integrity and cause for dismissal with a failing grade, possibly expulsion (UT's academic integrity policy). In particular, no materials used in this class, including, but not limited to, lecture hand-outs, videos, assessments (papers, projects, homework assignments), in-class materials, review sheets, and additional problem sets, may be shared online or with anyone outside of the class unless you have the instructor’s explicit, written permission. Any materials found online (e.g. in CourseHero) that are associated with you, or any suspected unauthorized sharing of materials, will be reported to Student Conduct and Academic Integrity in the Office of the Dean of Students. These reports can result in sanctions, including failure in the course.

The use of artificial intelligence tools (such as ChatGPT or Github co-pilot) in this class shall be permitted on a limited basis for programming assignments. You are also welcome to seek my prior-approval to use AI writing tools on any assignment. In either instance, AI writing tools should be used with caution and proper citation, as the use of AI should be properly attributed. Using AI writing tools without my permission or authorization, or failing to properly cite AI even where permitted, shall constitute a violation of UT Austin’s Institutional Rules on academic integrity.

The final project website is due by 10 PM April 17, 2024